Incidental Mutation 'R6223:Tab1'
ID504165
Institutional Source Beutler Lab
Gene Symbol Tab1
Ensembl Gene ENSMUSG00000022414
Gene NameTGF-beta activated kinase 1/MAP3K7 binding protein 1
Synonyms2310012M03Rik, Map3k7ip1, b2b449Clo, Tak1-binding protein 1
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location80133127-80161707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80148263 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 24 (C24S)
Ref Sequence ENSEMBL: ENSMUSP00000023050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023050] [ENSMUST00000229320]
PDB Structure Structural basis of autoactivation of p38 alpha induced by TAB1 (Monoclinic crystal form) [X-RAY DIFFRACTION]
Structural basis of autoactivation of p38 alpha induced by TAB1 (Tetragonal crystal form) [X-RAY DIFFRACTION]
Structural basis of autoactivation of p38 alpha induced by TAB1 (Tetragonal crystal form with bound sulphate) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000023050
AA Change: C24S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023050
Gene: ENSMUSG00000022414
AA Change: C24S

DomainStartEndE-ValueType
PP2Cc 26 363 7.45e-40 SMART
low complexity region 397 408 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
PDB:4L3P|A 466 502 6e-17 PDB
Predicted Effect silent
Transcript: ENSMUST00000229320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230479
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a regulator of the MAP kinase kinase kinase MAP3K7/TAK1, which is known to mediate various intracellular signaling pathways, such as those induced by TGF beta, interleukin 1, and WNT-1. This protein interacts and thus activates TAK1 kinase. It has been shown that the C-terminal portion of this protein is sufficient for binding and activation of TAK1, while a portion of the N-terminus acts as a dominant-negative inhibitor of TGF beta, suggesting that this protein may function as a mediator between TGF beta receptors and TAK1. This protein can also interact with and activate the mitogen-activated protein kinase 14 (MAPK14/p38alpha), and thus represents an alternative activation pathway, in addition to the MAPKK pathways, which contributes to the biological responses of MAPK14 to various stimuli. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant fetuses exhibit edema, hemorrhaging, cardiovascular and pulmonary dysmorphogenesis, and die in the late stages of gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Tab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Tab1 APN 15 80148830 missense probably benign 0.05
memento UTSW 15 80153668 missense probably damaging 0.96
Memoir UTSW 15 80153740 missense probably damaging 1.00
R0085:Tab1 UTSW 15 80155893 missense probably benign 0.00
R1341:Tab1 UTSW 15 80160114 missense possibly damaging 0.86
R1835:Tab1 UTSW 15 80148296 missense probably benign 0.42
R1907:Tab1 UTSW 15 80153668 missense probably damaging 0.96
R3113:Tab1 UTSW 15 80148260 missense probably benign 0.23
R3943:Tab1 UTSW 15 80153740 missense probably damaging 1.00
R3944:Tab1 UTSW 15 80153740 missense probably damaging 1.00
R4845:Tab1 UTSW 15 80152763 missense probably damaging 1.00
R5345:Tab1 UTSW 15 80149813 missense possibly damaging 0.48
R5696:Tab1 UTSW 15 80148729 nonsense probably null
R6242:Tab1 UTSW 15 80155770 nonsense probably null
R6561:Tab1 UTSW 15 80148830 missense probably benign 0.05
R7239:Tab1 UTSW 15 80133171 missense probably benign 0.15
R7422:Tab1 UTSW 15 80160244 missense probably benign 0.00
R7810:Tab1 UTSW 15 80158798 missense possibly damaging 0.86
R7922:Tab1 UTSW 15 80158865 missense possibly damaging 0.52
R7951:Tab1 UTSW 15 80158857 missense probably damaging 0.98
R8007:Tab1 UTSW 15 80158768 missense possibly damaging 0.94
R8037:Tab1 UTSW 15 80160270 missense probably benign 0.08
R8038:Tab1 UTSW 15 80160270 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCAGCTTTAGGGTTCCCAAG -3'
(R):5'- AGGTGGCAGGACAGTATCTTTTC -3'

Sequencing Primer
(F):5'- CAGGAAATGCTTTAGTTAGAGTCCC -3'
(R):5'- GGCAGGACAGTATCTTTTCTTGCTC -3'
Posted On2018-02-28