Incidental Mutation 'R6223:Pi4ka'
ID 504167
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Name phosphatidylinositol 4-kinase alpha
Synonyms Pik4ca
MMRRC Submission 044354-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 17098215-17224178 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 17175435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 464 (Y464*)
Ref Sequence ENSEMBL: ENSMUSP00000156049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000154364] [ENSMUST00000232232]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000036161
AA Change: Y464*
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: Y464*

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154364
AA Change: Y464*
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: Y464*

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably null
Transcript: ENSMUST00000232232
AA Change: Y464*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,269,873 (GRCm39) R8S probably benign Het
Abca8b A G 11: 109,868,672 (GRCm39) V164A probably benign Het
Acadm C A 3: 153,644,186 (GRCm39) probably null Het
Ap3b2 G A 7: 81,123,210 (GRCm39) R435* probably null Het
Art2b A G 7: 101,229,158 (GRCm39) F247S possibly damaging Het
C1rb T A 6: 124,551,539 (GRCm39) D216E probably benign Het
Casz1 C A 4: 149,017,840 (GRCm39) D90E probably damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Cdc25a C A 9: 109,718,842 (GRCm39) P409T possibly damaging Het
Cidea A C 18: 67,491,809 (GRCm39) K23T possibly damaging Het
Clspn T A 4: 126,479,961 (GRCm39) D1101E probably damaging Het
Col10a1 A T 10: 34,271,183 (GRCm39) D385V probably damaging Het
Crat C T 2: 30,297,042 (GRCm39) V304I probably benign Het
Cyp2d26 A T 15: 82,675,918 (GRCm39) W265R probably benign Het
Dock8 A T 19: 25,138,416 (GRCm39) Y1247F probably benign Het
Dync2i1 T C 12: 116,221,078 (GRCm39) D11G possibly damaging Het
Eed A G 7: 89,605,495 (GRCm39) Y365H probably damaging Het
Fabp5 T A 3: 10,080,170 (GRCm39) F73L probably benign Het
Fbn1 C T 2: 125,254,591 (GRCm39) C224Y possibly damaging Het
Ggcx T C 6: 72,406,588 (GRCm39) F684L probably damaging Het
Glrp1 G A 1: 88,431,164 (GRCm39) Q69* probably null Het
Gm29797 T C 2: 181,300,850 (GRCm39) V115A possibly damaging Het
Gtf3c1 C T 7: 125,275,797 (GRCm39) R543K probably benign Het
Ifih1 T C 2: 62,428,603 (GRCm39) I891V probably benign Het
Ifnar2 C T 16: 91,184,876 (GRCm39) T89M probably damaging Het
Kat6a C A 8: 23,430,442 (GRCm39) N1932K unknown Het
Mgat5 A T 1: 127,310,716 (GRCm39) D210V possibly damaging Het
Mmel1 A G 4: 154,956,159 (GRCm39) probably null Het
Myh3 G T 11: 66,988,843 (GRCm39) V1499L probably benign Het
Ncan A C 8: 70,562,604 (GRCm39) D551E probably benign Het
Nol11 G T 11: 107,062,442 (GRCm39) T598K possibly damaging Het
Olfml3 G A 3: 103,643,776 (GRCm39) R202W probably damaging Het
Or2w4 G A 13: 21,795,536 (GRCm39) T201I probably benign Het
Or4e2 A G 14: 52,688,136 (GRCm39) R89G probably benign Het
Pcdh9 T C 14: 93,253,169 (GRCm39) K1131E probably benign Het
Pcolce A G 5: 137,603,561 (GRCm39) M424T probably damaging Het
Pi16 C A 17: 29,546,413 (GRCm39) S397* probably null Het
Pik3c2b T A 1: 132,998,095 (GRCm39) L324M probably damaging Het
Prdm2 T C 4: 142,868,777 (GRCm39) N179S probably benign Het
Prss56 C T 1: 87,113,134 (GRCm39) P183S probably benign Het
Prx T G 7: 27,216,261 (GRCm39) M393R probably damaging Het
Qpctl T C 7: 18,877,134 (GRCm39) D328G probably damaging Het
Qser1 A G 2: 104,617,993 (GRCm39) S940P probably benign Het
Rchy1 G A 5: 92,105,826 (GRCm39) R41W probably damaging Het
Scp2d1 T C 2: 144,665,868 (GRCm39) I69T possibly damaging Het
Sirpb1a A G 3: 15,444,086 (GRCm39) V388A probably benign Het
Ssu2 G T 6: 112,353,409 (GRCm39) C238* probably null Het
Stub1 C T 17: 26,051,787 (GRCm39) G14D probably damaging Het
Tab1 T A 15: 80,032,464 (GRCm39) C24S probably damaging Het
Tdrd1 T C 19: 56,854,282 (GRCm39) V1076A probably damaging Het
Tex10 T C 4: 48,468,525 (GRCm39) R134G probably damaging Het
Tg T A 15: 66,579,771 (GRCm39) N1525K probably benign Het
Tll2 G A 19: 41,124,391 (GRCm39) T208I possibly damaging Het
Tmem232 T C 17: 65,807,191 (GRCm39) M1V probably null Het
Ttc7b A G 12: 100,353,368 (GRCm39) probably null Het
Ubb A G 11: 62,443,351 (GRCm39) E127G possibly damaging Het
Ulk2 A T 11: 61,678,330 (GRCm39) Y796* probably null Het
Vdac2 G A 14: 21,895,246 (GRCm39) G265R possibly damaging Het
Vmn2r45 A T 7: 8,486,301 (GRCm39) V329E probably benign Het
Zbtb47 G A 9: 121,592,853 (GRCm39) R391Q possibly damaging Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17,126,008 (GRCm39) missense probably benign
IGL00984:Pi4ka APN 16 17,176,796 (GRCm39) nonsense probably null
IGL01066:Pi4ka APN 16 17,166,637 (GRCm39) splice site probably benign
IGL01460:Pi4ka APN 16 17,175,515 (GRCm39) missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17,127,222 (GRCm39) missense probably benign 0.22
IGL01518:Pi4ka APN 16 17,098,599 (GRCm39) missense probably benign 0.03
IGL01533:Pi4ka APN 16 17,126,065 (GRCm39) missense probably benign 0.30
IGL01565:Pi4ka APN 16 17,207,306 (GRCm39) utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17,114,752 (GRCm39) splice site probably benign
IGL01685:Pi4ka APN 16 17,143,066 (GRCm39) missense probably benign 0.09
IGL01734:Pi4ka APN 16 17,115,124 (GRCm39) missense probably benign 0.23
IGL01799:Pi4ka APN 16 17,207,235 (GRCm39) missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17,196,347 (GRCm39) missense probably benign 0.15
IGL02092:Pi4ka APN 16 17,136,360 (GRCm39) missense probably benign 0.00
IGL02113:Pi4ka APN 16 17,191,279 (GRCm39) missense probably benign 0.00
IGL02177:Pi4ka APN 16 17,136,146 (GRCm39) missense probably benign 0.09
IGL02400:Pi4ka APN 16 17,111,748 (GRCm39) missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17,196,296 (GRCm39) splice site probably benign
IGL02474:Pi4ka APN 16 17,143,293 (GRCm39) missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17,135,217 (GRCm39) missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17,113,325 (GRCm39) missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17,109,032 (GRCm39) missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17,176,753 (GRCm39) splice site probably benign
IGL02828:Pi4ka APN 16 17,098,575 (GRCm39) intron probably benign
IGL02939:Pi4ka APN 16 17,172,074 (GRCm39) missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17,100,539 (GRCm39) missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17,172,053 (GRCm39) missense probably damaging 0.99
arachnoid UTSW 16 17,103,145 (GRCm39) unclassified probably benign
dove_bar UTSW 16 17,143,916 (GRCm39) splice site probably null
mia UTSW 16 17,194,846 (GRCm39) missense possibly damaging 0.89
Pia UTSW 16 17,098,908 (GRCm39) missense probably damaging 1.00
G1patch:Pi4ka UTSW 16 17,194,846 (GRCm39) missense possibly damaging 0.89
IGL03098:Pi4ka UTSW 16 17,143,891 (GRCm39) missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17,133,399 (GRCm39) splice site probably benign
R0054:Pi4ka UTSW 16 17,142,978 (GRCm39) missense probably null 1.00
R0054:Pi4ka UTSW 16 17,142,978 (GRCm39) missense probably null 1.00
R0243:Pi4ka UTSW 16 17,115,499 (GRCm39) missense probably benign 0.44
R0374:Pi4ka UTSW 16 17,100,796 (GRCm39) unclassified probably benign
R0478:Pi4ka UTSW 16 17,127,175 (GRCm39) missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17,125,582 (GRCm39) missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17,111,765 (GRCm39) missense probably benign 0.00
R0918:Pi4ka UTSW 16 17,103,124 (GRCm39) missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17,207,216 (GRCm39) missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17,115,401 (GRCm39) splice site probably benign
R1455:Pi4ka UTSW 16 17,181,818 (GRCm39) missense probably benign 0.02
R1479:Pi4ka UTSW 16 17,191,264 (GRCm39) missense probably benign 0.08
R1490:Pi4ka UTSW 16 17,204,132 (GRCm39) missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17,099,764 (GRCm39) missense probably null
R1594:Pi4ka UTSW 16 17,191,283 (GRCm39) splice site probably benign
R1641:Pi4ka UTSW 16 17,194,894 (GRCm39) missense probably benign 0.00
R1694:Pi4ka UTSW 16 17,113,240 (GRCm39) missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17,098,614 (GRCm39) missense probably benign 0.00
R1864:Pi4ka UTSW 16 17,185,389 (GRCm39) nonsense probably null
R2036:Pi4ka UTSW 16 17,120,976 (GRCm39) missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17,185,371 (GRCm39) missense probably benign 0.44
R2844:Pi4ka UTSW 16 17,168,657 (GRCm39) missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17,185,414 (GRCm39) missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17,103,145 (GRCm39) unclassified probably benign
R3972:Pi4ka UTSW 16 17,111,739 (GRCm39) missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17,185,303 (GRCm39) missense probably benign 0.00
R4385:Pi4ka UTSW 16 17,204,129 (GRCm39) missense probably benign 0.13
R4427:Pi4ka UTSW 16 17,098,908 (GRCm39) missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17,100,246 (GRCm39) missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17,100,237 (GRCm39) missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17,114,901 (GRCm39) missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17,195,039 (GRCm39) missense probably benign 0.12
R4804:Pi4ka UTSW 16 17,126,025 (GRCm39) missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17,176,225 (GRCm39) missense
R4893:Pi4ka UTSW 16 17,194,900 (GRCm39) missense probably benign 0.21
R4896:Pi4ka UTSW 16 17,195,033 (GRCm39) missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17,195,033 (GRCm39) missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17,120,946 (GRCm39) missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17,127,261 (GRCm39) missense probably benign 0.02
R5104:Pi4ka UTSW 16 17,098,914 (GRCm39) missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17,140,917 (GRCm39) missense probably benign 0.01
R5173:Pi4ka UTSW 16 17,168,770 (GRCm39) missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17,176,909 (GRCm39) missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17,140,894 (GRCm39) missense probably benign 0.00
R5327:Pi4ka UTSW 16 17,143,277 (GRCm39) missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17,111,817 (GRCm39) missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17,098,951 (GRCm39) missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17,172,736 (GRCm39) missense probably benign 0.29
R5857:Pi4ka UTSW 16 17,176,848 (GRCm39) missense probably benign 0.00
R5951:Pi4ka UTSW 16 17,121,006 (GRCm39) missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17,099,815 (GRCm39) missense
R6041:Pi4ka UTSW 16 17,178,436 (GRCm39) missense probably benign
R6416:Pi4ka UTSW 16 17,176,186 (GRCm39) missense probably benign 0.22
R6535:Pi4ka UTSW 16 17,118,900 (GRCm39) missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17,168,694 (GRCm39) missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17,143,916 (GRCm39) splice site probably null
R6723:Pi4ka UTSW 16 17,194,846 (GRCm39) missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17,194,846 (GRCm39) missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17,194,846 (GRCm39) missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17,194,846 (GRCm39) missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17,194,846 (GRCm39) missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17,194,846 (GRCm39) missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17,194,846 (GRCm39) missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17,194,846 (GRCm39) missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17,143,852 (GRCm39) missense probably damaging 1.00
R6788:Pi4ka UTSW 16 17,194,846 (GRCm39) missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17,121,285 (GRCm39) missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17,143,091 (GRCm39) missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17,114,931 (GRCm39) unclassified probably benign
R7055:Pi4ka UTSW 16 17,134,879 (GRCm39) utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17,223,496 (GRCm39) critical splice donor site probably null
R7533:Pi4ka UTSW 16 17,115,525 (GRCm39) missense
R7552:Pi4ka UTSW 16 17,109,080 (GRCm39) missense
R7581:Pi4ka UTSW 16 17,118,924 (GRCm39) missense
R7622:Pi4ka UTSW 16 17,111,841 (GRCm39) missense
R7717:Pi4ka UTSW 16 17,194,787 (GRCm39) missense
R8048:Pi4ka UTSW 16 17,120,991 (GRCm39) missense
R8052:Pi4ka UTSW 16 17,174,030 (GRCm39) missense
R8079:Pi4ka UTSW 16 17,120,924 (GRCm39) missense
R8123:Pi4ka UTSW 16 17,098,956 (GRCm39) missense
R8211:Pi4ka UTSW 16 17,100,769 (GRCm39) missense
R8310:Pi4ka UTSW 16 17,171,912 (GRCm39) critical splice donor site probably null
R8322:Pi4ka UTSW 16 17,175,437 (GRCm39) missense
R8509:Pi4ka UTSW 16 17,172,008 (GRCm39) missense
R8735:Pi4ka UTSW 16 17,136,234 (GRCm39) missense
R8912:Pi4ka UTSW 16 17,207,230 (GRCm39) missense
R8917:Pi4ka UTSW 16 17,130,310 (GRCm39) missense
R8921:Pi4ka UTSW 16 17,125,604 (GRCm39) missense
R8941:Pi4ka UTSW 16 17,114,807 (GRCm39) unclassified probably benign
R9002:Pi4ka UTSW 16 17,117,317 (GRCm39) missense
R9203:Pi4ka UTSW 16 17,100,165 (GRCm39) missense
R9222:Pi4ka UTSW 16 17,176,225 (GRCm39) missense
R9230:Pi4ka UTSW 16 17,099,788 (GRCm39) missense
R9262:Pi4ka UTSW 16 17,120,859 (GRCm39) missense
R9338:Pi4ka UTSW 16 17,135,227 (GRCm39) missense
R9374:Pi4ka UTSW 16 17,125,574 (GRCm39) missense
R9436:Pi4ka UTSW 16 17,125,670 (GRCm39) missense
R9499:Pi4ka UTSW 16 17,125,574 (GRCm39) missense
R9501:Pi4ka UTSW 16 17,204,156 (GRCm39) missense
R9551:Pi4ka UTSW 16 17,125,574 (GRCm39) missense
R9705:Pi4ka UTSW 16 17,099,815 (GRCm39) missense
RF007:Pi4ka UTSW 16 17,115,097 (GRCm39) missense
U24488:Pi4ka UTSW 16 17,143,040 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGATTACAAGGGGCCTTCAG -3'
(R):5'- TTAAGCATCCCAGGGCCTTG -3'

Sequencing Primer
(F):5'- CCTTCAGTGGGAGGCAGAG -3'
(R):5'- TGTAGGCAGTCCTTTCCAGACAG -3'
Posted On 2018-02-28