Incidental Mutation 'R6223:Pi4ka'
ID504167
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Namephosphatidylinositol 4-kinase alpha
SynonymsPik4ca
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location17280351-17406314 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 17357571 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 464 (Y464*)
Ref Sequence ENSEMBL: ENSMUSP00000156049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000154364] [ENSMUST00000232232]
Predicted Effect probably null
Transcript: ENSMUST00000036161
AA Change: Y464*
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: Y464*

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154364
AA Change: Y464*
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: Y464*

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably null
Transcript: ENSMUST00000232232
AA Change: Y464*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
dove_bar UTSW 16 17326052 splice site probably null
mia UTSW 16 17376982 missense possibly damaging 0.89
Pia UTSW 16 17281044 missense probably damaging 1.00
G1patch:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
R7533:Pi4ka UTSW 16 17297661 missense
R7552:Pi4ka UTSW 16 17291216 missense
R7581:Pi4ka UTSW 16 17301060 missense
R7622:Pi4ka UTSW 16 17293977 missense
R7717:Pi4ka UTSW 16 17376923 missense
R8048:Pi4ka UTSW 16 17303127 missense
R8052:Pi4ka UTSW 16 17356166 missense
R8079:Pi4ka UTSW 16 17303060 missense
R8123:Pi4ka UTSW 16 17281092 missense
R8211:Pi4ka UTSW 16 17282905 missense
R8310:Pi4ka UTSW 16 17354048 critical splice donor site probably null
R8322:Pi4ka UTSW 16 17357573 missense
R8509:Pi4ka UTSW 16 17354144 missense
R8735:Pi4ka UTSW 16 17318370 missense
RF007:Pi4ka UTSW 16 17297233 missense
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGATTACAAGGGGCCTTCAG -3'
(R):5'- TTAAGCATCCCAGGGCCTTG -3'

Sequencing Primer
(F):5'- CCTTCAGTGGGAGGCAGAG -3'
(R):5'- TGTAGGCAGTCCTTTCCAGACAG -3'
Posted On2018-02-28