Incidental Mutation 'R6223:Stub1'
ID504169
Institutional Source Beutler Lab
Gene Symbol Stub1
Ensembl Gene ENSMUSG00000039615
Gene NameSTIP1 homology and U-Box containing protein 1
Synonyms0610033N24Rik, 2210017D18Rik, 2310040B03Rik, CHIP
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R6223 (G1)
Quality Score111.008
Status Not validated
Chromosome17
Chromosomal Location25830636-25833361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25832813 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 14 (G14D)
Ref Sequence ENSEMBL: ENSMUSP00000040431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026831] [ENSMUST00000026832] [ENSMUST00000026833] [ENSMUST00000044911] [ENSMUST00000123582] [ENSMUST00000133595] [ENSMUST00000184865] [ENSMUST00000183929]
PDB Structure CRYSTAL STRUCTURE OF THE CHIP U-BOX E3 UBIQUITIN LIGASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CHIP-UBC13-UEV1A COMPLEX [X-RAY DIFFRACTION]
Crystal structure of TPR domain of CHIP complexed with pseudophosphorylated Smad1 peptide [X-RAY DIFFRACTION]
Crystal structure of the TPR domain of CHIP complexed with Hsp70-C peptide [X-RAY DIFFRACTION]
Crystal structure of the TPR domain of CHIP complexed with phosphorylated Smad1 peptide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026831
SMART Domains Protein: ENSMUSP00000026831
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 5e-7 SMART
Blast:EFh 43 71 9e-11 BLAST
transmembrane domain 129 151 N/A INTRINSIC
Pfam:Rhomboid 174 331 6.7e-36 PFAM
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026833
SMART Domains Protein: ENSMUSP00000026833
Gene: ENSMUSG00000025737

DomainStartEndE-ValueType
Blast:WD40 19 53 6e-8 BLAST
WD40 68 103 2.13e1 SMART
WD40 109 149 5.77e-5 SMART
WD40 152 192 4.48e-2 SMART
WD40 196 236 1.48e-11 SMART
WD40 244 282 1.66e0 SMART
WD40 286 327 2.48e0 SMART
low complexity region 605 623 N/A INTRINSIC
Blast:RING 743 780 2e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000044911
AA Change: G14D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040431
Gene: ENSMUSG00000039615
AA Change: G14D

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
TPR 27 60 2.43e1 SMART
TPR 61 94 1.48e-7 SMART
TPR 95 128 4.52e-3 SMART
low complexity region 168 180 N/A INTRINSIC
Ubox 231 294 1.27e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123560
Predicted Effect probably benign
Transcript: ENSMUST00000123582
SMART Domains Protein: ENSMUSP00000119840
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
low complexity region 158 172 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123692
Predicted Effect probably benign
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144589
Predicted Effect probably benign
Transcript: ENSMUST00000152434
SMART Domains Protein: ENSMUSP00000119378
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175335
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Predicted Effect probably benign
Transcript: ENSMUST00000184865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Predicted Effect probably benign
Transcript: ENSMUST00000183929
SMART Domains Protein: ENSMUSP00000139046
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 9e-6 SMART
Blast:EFh 43 70 2e-9 BLAST
transmembrane domain 136 155 N/A INTRINSIC
Pfam:Rhomboid 178 327 1e-27 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing tetratricopeptide repeat and a U-box that functions as a ubiquitin ligase/cochaperone. The encoded protein binds to and ubiquitinates shock cognate 71 kDa protein (Hspa8) and DNA polymerase beta (Polb), among other targets. Mutations in this gene cause spinocerebellar ataxia, autosomal recessive 16. Alternative splicing results in multiple transcript variants. There is a pseudogene for this gene on chromosome 2. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygous null mice develop normally but are susceptible to stress-induced apoptosis of multiple organs. Increased peri- and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Stub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0619:Stub1 UTSW 17 25831322 splice site probably null
R1553:Stub1 UTSW 17 25832123 missense probably damaging 1.00
R2095:Stub1 UTSW 17 25830890 missense probably damaging 1.00
R3889:Stub1 UTSW 17 25831302 unclassified probably benign
R4626:Stub1 UTSW 17 25831871 splice site probably null
R5070:Stub1 UTSW 17 25832138 missense probably damaging 1.00
R7159:Stub1 UTSW 17 25832064 missense probably benign 0.13
R7726:Stub1 UTSW 17 25831132 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTGTCCGGGATCACAAAAC -3'
(R):5'- CTAAGGGAACTGGCTCAATCCAC -3'

Sequencing Primer
(F):5'- GATCACAAAACTGGGAGGCACATC -3'
(R):5'- TCAATCCACGAGGCTCCG -3'
Posted On2018-02-28