Incidental Mutation 'R6223:Cidea'
ID504172
Institutional Source Beutler Lab
Gene Symbol Cidea
Ensembl Gene ENSMUSG00000024526
Gene Namecell death-inducing DNA fragmentation factor, alpha subunit-like effector A
Synonyms
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location67343564-67367794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 67358739 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 23 (K23T)
Ref Sequence ENSEMBL: ENSMUSP00000025404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025404]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025404
AA Change: K23T

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025404
Gene: ENSMUSG00000024526
AA Change: K23T

DomainStartEndE-ValueType
CAD 35 108 9.62e-48 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the mouse protein Cidea that has been shown to activate apoptosis. This activation of apoptosis is inhibited by the DNA fragmentation factor DFF45 but not by caspase inhibitors. Mice that lack functional Cidea have higher metabolic rates, higher lipolysis in brown adipose tissue and higher core body temperatures when subjected to cold. These mice are also resistant to diet-induced obesity and diabetes. This suggests that in mice this gene product plays a role in thermogenesis and lipolysis. Alternatively spliced transcripts have been identified. [provided by RefSeq, Aug 2010]
PHENOTYPE: Nullizygous mice show higher metabolic rate, lipolysis in BAT and core body temperature when subjected to cold treatment. They are lean and resistant to diet-induced obesity. Aging homozygotes exhibit dry eyes and hair, reduced sebaceous lipid secretion, hair loss, and poor water repulsion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Cidea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:Cidea APN 18 67366511 missense probably damaging 1.00
R1586:Cidea UTSW 18 67360160 missense probably damaging 1.00
R1702:Cidea UTSW 18 67366421 missense probably damaging 1.00
R4559:Cidea UTSW 18 67360228 nonsense probably null
R4702:Cidea UTSW 18 67367428 missense probably benign 0.30
R5153:Cidea UTSW 18 67367420 missense probably damaging 1.00
R5384:Cidea UTSW 18 67360166 missense probably damaging 1.00
R7223:Cidea UTSW 18 67366421 missense probably damaging 1.00
R7593:Cidea UTSW 18 67360213 missense probably benign 0.00
R7866:Cidea UTSW 18 67358784 missense probably damaging 1.00
R8738:Cidea UTSW 18 67366415 nonsense probably null
Z1176:Cidea UTSW 18 67358853 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGTACGCACAAGGAGCAAAATC -3'
(R):5'- AATGCTTGTGTCTTATCACTGGC -3'

Sequencing Primer
(F):5'- TGAAGGTCCTGAGTTCAAATCCCAG -3'
(R):5'- GTGTCTTATCACTGGCTTACTGC -3'
Posted On2018-02-28