Incidental Mutation 'R6223:Tdrd1'
ID 504175
Institutional Source Beutler Lab
Gene Symbol Tdrd1
Ensembl Gene ENSMUSG00000025081
Gene Name tudor domain containing 1
Synonyms MTR-1
MMRRC Submission 044354-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.382) question?
Stock # R6223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 56814641-56858444 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56854282 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1076 (V1076A)
Ref Sequence ENSEMBL: ENSMUSP00000112786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078723] [ENSMUST00000111604] [ENSMUST00000111606] [ENSMUST00000121249]
AlphaFold Q99MV1
Predicted Effect probably damaging
Transcript: ENSMUST00000078723
AA Change: V1076A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077785
Gene: ENSMUSG00000025081
AA Change: V1076A

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111604
AA Change: V1076A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107231
Gene: ENSMUSG00000025081
AA Change: V1076A

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111606
AA Change: V1076A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107233
Gene: ENSMUSG00000025081
AA Change: V1076A

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121249
AA Change: V1076A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112786
Gene: ENSMUSG00000025081
AA Change: V1076A

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 9.9e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a tudor domain protein. Alternatively spliced transcript variants have been described but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male homozygous mice are sterile, displaying postnatal spermatogenic defects. Females are fertile. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,269,873 (GRCm39) R8S probably benign Het
Abca8b A G 11: 109,868,672 (GRCm39) V164A probably benign Het
Acadm C A 3: 153,644,186 (GRCm39) probably null Het
Ap3b2 G A 7: 81,123,210 (GRCm39) R435* probably null Het
Art2b A G 7: 101,229,158 (GRCm39) F247S possibly damaging Het
C1rb T A 6: 124,551,539 (GRCm39) D216E probably benign Het
Casz1 C A 4: 149,017,840 (GRCm39) D90E probably damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Cdc25a C A 9: 109,718,842 (GRCm39) P409T possibly damaging Het
Cidea A C 18: 67,491,809 (GRCm39) K23T possibly damaging Het
Clspn T A 4: 126,479,961 (GRCm39) D1101E probably damaging Het
Col10a1 A T 10: 34,271,183 (GRCm39) D385V probably damaging Het
Crat C T 2: 30,297,042 (GRCm39) V304I probably benign Het
Cyp2d26 A T 15: 82,675,918 (GRCm39) W265R probably benign Het
Dock8 A T 19: 25,138,416 (GRCm39) Y1247F probably benign Het
Dync2i1 T C 12: 116,221,078 (GRCm39) D11G possibly damaging Het
Eed A G 7: 89,605,495 (GRCm39) Y365H probably damaging Het
Fabp5 T A 3: 10,080,170 (GRCm39) F73L probably benign Het
Fbn1 C T 2: 125,254,591 (GRCm39) C224Y possibly damaging Het
Ggcx T C 6: 72,406,588 (GRCm39) F684L probably damaging Het
Glrp1 G A 1: 88,431,164 (GRCm39) Q69* probably null Het
Gm29797 T C 2: 181,300,850 (GRCm39) V115A possibly damaging Het
Gtf3c1 C T 7: 125,275,797 (GRCm39) R543K probably benign Het
Ifih1 T C 2: 62,428,603 (GRCm39) I891V probably benign Het
Ifnar2 C T 16: 91,184,876 (GRCm39) T89M probably damaging Het
Kat6a C A 8: 23,430,442 (GRCm39) N1932K unknown Het
Mgat5 A T 1: 127,310,716 (GRCm39) D210V possibly damaging Het
Mmel1 A G 4: 154,956,159 (GRCm39) probably null Het
Myh3 G T 11: 66,988,843 (GRCm39) V1499L probably benign Het
Ncan A C 8: 70,562,604 (GRCm39) D551E probably benign Het
Nol11 G T 11: 107,062,442 (GRCm39) T598K possibly damaging Het
Olfml3 G A 3: 103,643,776 (GRCm39) R202W probably damaging Het
Or2w4 G A 13: 21,795,536 (GRCm39) T201I probably benign Het
Or4e2 A G 14: 52,688,136 (GRCm39) R89G probably benign Het
Pcdh9 T C 14: 93,253,169 (GRCm39) K1131E probably benign Het
Pcolce A G 5: 137,603,561 (GRCm39) M424T probably damaging Het
Pi16 C A 17: 29,546,413 (GRCm39) S397* probably null Het
Pi4ka A T 16: 17,175,435 (GRCm39) Y464* probably null Het
Pik3c2b T A 1: 132,998,095 (GRCm39) L324M probably damaging Het
Prdm2 T C 4: 142,868,777 (GRCm39) N179S probably benign Het
Prss56 C T 1: 87,113,134 (GRCm39) P183S probably benign Het
Prx T G 7: 27,216,261 (GRCm39) M393R probably damaging Het
Qpctl T C 7: 18,877,134 (GRCm39) D328G probably damaging Het
Qser1 A G 2: 104,617,993 (GRCm39) S940P probably benign Het
Rchy1 G A 5: 92,105,826 (GRCm39) R41W probably damaging Het
Scp2d1 T C 2: 144,665,868 (GRCm39) I69T possibly damaging Het
Sirpb1a A G 3: 15,444,086 (GRCm39) V388A probably benign Het
Ssu2 G T 6: 112,353,409 (GRCm39) C238* probably null Het
Stub1 C T 17: 26,051,787 (GRCm39) G14D probably damaging Het
Tab1 T A 15: 80,032,464 (GRCm39) C24S probably damaging Het
Tex10 T C 4: 48,468,525 (GRCm39) R134G probably damaging Het
Tg T A 15: 66,579,771 (GRCm39) N1525K probably benign Het
Tll2 G A 19: 41,124,391 (GRCm39) T208I possibly damaging Het
Tmem232 T C 17: 65,807,191 (GRCm39) M1V probably null Het
Ttc7b A G 12: 100,353,368 (GRCm39) probably null Het
Ubb A G 11: 62,443,351 (GRCm39) E127G possibly damaging Het
Ulk2 A T 11: 61,678,330 (GRCm39) Y796* probably null Het
Vdac2 G A 14: 21,895,246 (GRCm39) G265R possibly damaging Het
Vmn2r45 A T 7: 8,486,301 (GRCm39) V329E probably benign Het
Zbtb47 G A 9: 121,592,853 (GRCm39) R391Q possibly damaging Het
Other mutations in Tdrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Tdrd1 APN 19 56,839,896 (GRCm39) missense possibly damaging 0.51
IGL01366:Tdrd1 APN 19 56,843,734 (GRCm39) missense probably benign 0.00
IGL01569:Tdrd1 APN 19 56,822,841 (GRCm39) missense probably damaging 1.00
IGL02691:Tdrd1 APN 19 56,832,284 (GRCm39) missense probably damaging 0.99
3-1:Tdrd1 UTSW 19 56,850,127 (GRCm39) missense probably benign
R0081:Tdrd1 UTSW 19 56,819,703 (GRCm39) missense probably benign 0.16
R0139:Tdrd1 UTSW 19 56,831,630 (GRCm39) missense probably benign 0.00
R0254:Tdrd1 UTSW 19 56,830,998 (GRCm39) missense probably benign 0.02
R0686:Tdrd1 UTSW 19 56,844,483 (GRCm39) missense probably damaging 1.00
R0735:Tdrd1 UTSW 19 56,854,410 (GRCm39) nonsense probably null
R0740:Tdrd1 UTSW 19 56,827,531 (GRCm39) missense probably damaging 1.00
R1241:Tdrd1 UTSW 19 56,850,192 (GRCm39) missense probably benign
R1294:Tdrd1 UTSW 19 56,837,208 (GRCm39) splice site probably null
R1508:Tdrd1 UTSW 19 56,839,790 (GRCm39) missense probably damaging 1.00
R1655:Tdrd1 UTSW 19 56,831,648 (GRCm39) nonsense probably null
R1708:Tdrd1 UTSW 19 56,830,721 (GRCm39) missense probably benign 0.13
R1796:Tdrd1 UTSW 19 56,826,215 (GRCm39) missense probably damaging 0.98
R1840:Tdrd1 UTSW 19 56,830,744 (GRCm39) missense probably damaging 1.00
R2138:Tdrd1 UTSW 19 56,831,021 (GRCm39) missense probably benign 0.30
R2201:Tdrd1 UTSW 19 56,847,094 (GRCm39) missense probably benign 0.00
R2201:Tdrd1 UTSW 19 56,847,093 (GRCm39) missense probably benign 0.14
R2286:Tdrd1 UTSW 19 56,827,551 (GRCm39) missense probably benign 0.05
R2443:Tdrd1 UTSW 19 56,829,786 (GRCm39) missense probably null 0.01
R3001:Tdrd1 UTSW 19 56,850,182 (GRCm39) nonsense probably null
R3002:Tdrd1 UTSW 19 56,850,182 (GRCm39) nonsense probably null
R3418:Tdrd1 UTSW 19 56,819,663 (GRCm39) missense possibly damaging 0.87
R3419:Tdrd1 UTSW 19 56,819,663 (GRCm39) missense possibly damaging 0.87
R3707:Tdrd1 UTSW 19 56,854,425 (GRCm39) missense possibly damaging 0.86
R3978:Tdrd1 UTSW 19 56,855,066 (GRCm39) missense probably benign 0.01
R4077:Tdrd1 UTSW 19 56,819,505 (GRCm39) missense probably benign 0.22
R4083:Tdrd1 UTSW 19 56,831,662 (GRCm39) missense probably benign
R4193:Tdrd1 UTSW 19 56,839,773 (GRCm39) nonsense probably null
R5882:Tdrd1 UTSW 19 56,837,371 (GRCm39) missense probably damaging 1.00
R6073:Tdrd1 UTSW 19 56,831,655 (GRCm39) nonsense probably null
R6240:Tdrd1 UTSW 19 56,829,767 (GRCm39) missense probably benign 0.00
R6953:Tdrd1 UTSW 19 56,819,803 (GRCm39) missense probably damaging 0.98
R7090:Tdrd1 UTSW 19 56,839,833 (GRCm39) missense probably benign 0.28
R7643:Tdrd1 UTSW 19 56,826,140 (GRCm39) missense probably damaging 1.00
R7793:Tdrd1 UTSW 19 56,852,809 (GRCm39) missense probably damaging 0.99
R7972:Tdrd1 UTSW 19 56,837,134 (GRCm39) missense probably damaging 0.98
R7993:Tdrd1 UTSW 19 56,854,437 (GRCm39) splice site probably null
R8076:Tdrd1 UTSW 19 56,832,267 (GRCm39) missense probably damaging 0.96
R8346:Tdrd1 UTSW 19 56,830,699 (GRCm39) missense probably benign 0.44
R8400:Tdrd1 UTSW 19 56,837,081 (GRCm39) missense probably benign 0.05
R8553:Tdrd1 UTSW 19 56,831,584 (GRCm39) missense probably damaging 0.99
R8701:Tdrd1 UTSW 19 56,839,916 (GRCm39) missense possibly damaging 0.94
R8772:Tdrd1 UTSW 19 56,843,760 (GRCm39) missense probably damaging 0.99
R8906:Tdrd1 UTSW 19 56,831,145 (GRCm39) missense probably damaging 0.99
R9222:Tdrd1 UTSW 19 56,831,679 (GRCm39) missense probably benign 0.38
R9321:Tdrd1 UTSW 19 56,848,767 (GRCm39) missense probably damaging 1.00
R9665:Tdrd1 UTSW 19 56,819,572 (GRCm39) missense probably benign 0.04
R9747:Tdrd1 UTSW 19 56,847,101 (GRCm39) missense probably benign 0.17
R9756:Tdrd1 UTSW 19 56,831,662 (GRCm39) missense probably benign
X0020:Tdrd1 UTSW 19 56,844,492 (GRCm39) missense probably damaging 1.00
X0053:Tdrd1 UTSW 19 56,854,223 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TAAGCCTCGGTAGTGCATGG -3'
(R):5'- CTCTGCTGTGTATTACGCTTAAG -3'

Sequencing Primer
(F):5'- TAGTGACTGGCAACCACCTGTATG -3'
(R):5'- CGCTTAAGAAAGTACCTTTAGTGG -3'
Posted On 2018-02-28