Incidental Mutation 'R6224:Gp6'
ID504190
Institutional Source Beutler Lab
Gene Symbol Gp6
Ensembl Gene ENSMUSG00000078810
Gene Nameglycoprotein 6 (platelet)
SynonymsGpvi, 9830166G18Rik
MMRRC Submission 044355-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6224 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4363965-4397744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4394212 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 75 (F75I)
Ref Sequence ENSEMBL: ENSMUSP00000145740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108590] [ENSMUST00000206928]
Predicted Effect probably benign
Transcript: ENSMUST00000108590
AA Change: F75I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000104231
Gene: ENSMUSG00000078810
AA Change: F75I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 34 109 7.47e-3 SMART
IG 120 204 9.86e-3 SMART
transmembrane domain 266 285 N/A INTRINSIC
low complexity region 306 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178240
Predicted Effect probably benign
Transcript: ENSMUST00000206928
AA Change: F75I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a platelet membrane glycoprotein of the immunoglobulin superfamily. The encoded protein is a receptor for collagen and plays a critical role in collagen-induced platelet aggregation and thrombus formation. The encoded protein forms a complex with the Fc receptor gamma-chain that initiates the platelet activation signaling cascade upon collagen binding. Mutations in this gene are a cause of platelet-type bleeding disorder-11 (BDPLT11). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous with disruptions in this gene display functional abnormalities in their platelets including failure of the platelets to aggregate and to become activated. The effects on blood clotting are minor however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A C 11: 99,838,014 M1R probably null Het
4930505A04Rik A C 11: 30,454,815 N29K probably benign Het
Adamtsl4 T C 3: 95,681,729 Y464C probably damaging Het
Asgr2 T C 11: 70,098,246 V172A probably damaging Het
Atad1 T C 19: 32,698,628 Y132C probably damaging Het
Bpifa6 G A 2: 153,987,153 R200H probably damaging Het
Brd1 A T 15: 88,688,355 M1171K possibly damaging Het
Cadm2 A T 16: 66,664,395 L392Q probably damaging Het
Ccdc183 C T 2: 25,610,582 E333K possibly damaging Het
Cenpe T C 3: 135,243,775 I1335T possibly damaging Het
Cpxm2 T C 7: 132,143,731 N122D probably benign Het
Crls1 T A 2: 132,849,850 probably null Het
Cyp46a1 T C 12: 108,361,560 F460S probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcps T A 9: 35,136,481 T128S probably benign Het
Dcun1d3 A T 7: 119,859,491 L107* probably null Het
Eml1 T C 12: 108,514,508 F397S probably damaging Het
Fanca T A 8: 123,305,281 H348L possibly damaging Het
Foxo1 T A 3: 52,345,672 S419T probably benign Het
Gli3 T C 13: 15,725,145 V1039A probably benign Het
Gm5741 A T 8: 85,067,591 *73R probably null Het
Gpha2 T A 19: 6,227,112 I81N possibly damaging Het
Gspt1 C A 16: 11,224,542 V493L probably benign Het
Igsf10 C A 3: 59,325,510 C1934F probably damaging Het
Irgm1 T C 11: 48,866,886 T49A probably benign Het
Klc4 A G 17: 46,640,062 I207T possibly damaging Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Lama1 T C 17: 67,802,987 V2201A possibly damaging Het
Lilrb4a T A 10: 51,491,649 Y96N probably damaging Het
Lrfn2 A G 17: 49,096,351 T501A probably damaging Het
Lrriq1 A G 10: 103,215,757 I378T probably damaging Het
Mphosph8 T C 14: 56,668,353 M1T probably null Het
Nsd1 T C 13: 55,313,132 S2391P possibly damaging Het
Ogdhl G A 14: 32,342,061 G647D probably benign Het
Olfr480 T C 7: 108,066,742 I19V probably benign Het
Olfr813 A G 10: 129,857,192 K225E probably benign Het
Pbrm1 T A 14: 31,050,111 H387Q probably benign Het
Pdgfrb C A 18: 61,081,939 Y1013* probably null Het
Pitrm1 T C 13: 6,565,054 V562A probably damaging Het
Pnpla8 T C 12: 44,283,028 V121A possibly damaging Het
Psd4 T C 2: 24,401,557 L639P probably damaging Het
Psmc3 G T 2: 91,054,630 R47L probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sesn2 A G 4: 132,502,570 V50A probably benign Het
Slc6a16 G A 7: 45,261,148 G377S probably damaging Het
Slitrk1 A G 14: 108,912,022 F419S probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Spata31d1a T A 13: 59,706,320 probably benign Homo
Tgoln1 A T 6: 72,616,001 D165E possibly damaging Het
Tmprss15 T A 16: 79,024,378 T492S probably benign Het
Ttc37 C T 13: 76,118,291 T219M probably benign Het
Zc3h13 T A 14: 75,337,409 M1565K probably damaging Het
Zcwpw1 T C 5: 137,812,036 V358A possibly damaging Het
Zfp607a A G 7: 27,878,582 H359R probably damaging Het
Zzef1 T A 11: 72,855,383 V837E probably damaging Het
Other mutations in Gp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Gp6 APN 7 4394104 splice site probably benign
IGL02351:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02358:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02660:Gp6 APN 7 4384998 missense probably benign 0.01
IGL03081:Gp6 APN 7 4371648 missense probably benign 0.01
R0112:Gp6 UTSW 7 4370184 missense probably benign 0.08
R0112:Gp6 UTSW 7 4371627 missense probably benign 0.12
R0211:Gp6 UTSW 7 4373209 critical splice donor site probably null
R0356:Gp6 UTSW 7 4370142 splice site probably benign
R2006:Gp6 UTSW 7 4384989 missense probably benign 0.33
R2047:Gp6 UTSW 7 4373271 splice site probably benign
R5219:Gp6 UTSW 7 4368999 missense possibly damaging 0.70
R5571:Gp6 UTSW 7 4368900 missense probably damaging 1.00
R5639:Gp6 UTSW 7 4394131 missense probably damaging 1.00
R6555:Gp6 UTSW 7 4384930 missense probably damaging 0.99
R7625:Gp6 UTSW 7 4370174 missense probably benign 0.37
R8113:Gp6 UTSW 7 4394115 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GACTATTATTCACCGTGCGC -3'
(R):5'- GCTAACCTAGTGTCCGTGATTC -3'

Sequencing Primer
(F):5'- TTCATATTCCCCAAATGCAGAACTG -3'
(R):5'- AGTGTCCGTGATTCCCTTCCAAG -3'
Posted On2018-02-28