Incidental Mutation 'R6224:Olfr813'
ID504201
Institutional Source Beutler Lab
Gene Symbol Olfr813
Ensembl Gene ENSMUSG00000052818
Gene Nameolfactory receptor 813
SynonymsMOR108-3, GA_x6K02T2PULF-11535078-11536010
MMRRC Submission 044355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6224 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129855367-129858722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129857192 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 225 (K225E)
Ref Sequence ENSEMBL: ENSMUSP00000145260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064893] [ENSMUST00000204622]
Predicted Effect probably benign
Transcript: ENSMUST00000064893
AA Change: K225E

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000063431
Gene: ENSMUSG00000052818
AA Change: K225E

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.2e-49 PFAM
Pfam:7tm_1 39 288 3.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204622
AA Change: K225E

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000145260
Gene: ENSMUSG00000052818
AA Change: K225E

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 3.5e-49 PFAM
Pfam:7tm_1 54 303 1.3e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A C 11: 99,838,014 M1R probably null Het
4930505A04Rik A C 11: 30,454,815 N29K probably benign Het
Adamtsl4 T C 3: 95,681,729 Y464C probably damaging Het
Asgr2 T C 11: 70,098,246 V172A probably damaging Het
Atad1 T C 19: 32,698,628 Y132C probably damaging Het
Bpifa6 G A 2: 153,987,153 R200H probably damaging Het
Brd1 A T 15: 88,688,355 M1171K possibly damaging Het
Cadm2 A T 16: 66,664,395 L392Q probably damaging Het
Ccdc183 C T 2: 25,610,582 E333K possibly damaging Het
Cenpe T C 3: 135,243,775 I1335T possibly damaging Het
Cpxm2 T C 7: 132,143,731 N122D probably benign Het
Crls1 T A 2: 132,849,850 probably null Het
Cyp46a1 T C 12: 108,361,560 F460S probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcps T A 9: 35,136,481 T128S probably benign Het
Dcun1d3 A T 7: 119,859,491 L107* probably null Het
Eml1 T C 12: 108,514,508 F397S probably damaging Het
Fanca T A 8: 123,305,281 H348L possibly damaging Het
Foxo1 T A 3: 52,345,672 S419T probably benign Het
Gli3 T C 13: 15,725,145 V1039A probably benign Het
Gm5741 A T 8: 85,067,591 *73R probably null Het
Gp6 A T 7: 4,394,212 F75I probably benign Het
Gpha2 T A 19: 6,227,112 I81N possibly damaging Het
Gspt1 C A 16: 11,224,542 V493L probably benign Het
Igsf10 C A 3: 59,325,510 C1934F probably damaging Het
Irgm1 T C 11: 48,866,886 T49A probably benign Het
Klc4 A G 17: 46,640,062 I207T possibly damaging Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Lama1 T C 17: 67,802,987 V2201A possibly damaging Het
Lilrb4a T A 10: 51,491,649 Y96N probably damaging Het
Lrfn2 A G 17: 49,096,351 T501A probably damaging Het
Lrriq1 A G 10: 103,215,757 I378T probably damaging Het
Mphosph8 T C 14: 56,668,353 M1T probably null Het
Nsd1 T C 13: 55,313,132 S2391P possibly damaging Het
Ogdhl G A 14: 32,342,061 G647D probably benign Het
Olfr480 T C 7: 108,066,742 I19V probably benign Het
Pbrm1 T A 14: 31,050,111 H387Q probably benign Het
Pdgfrb C A 18: 61,081,939 Y1013* probably null Het
Pitrm1 T C 13: 6,565,054 V562A probably damaging Het
Pnpla8 T C 12: 44,283,028 V121A possibly damaging Het
Psd4 T C 2: 24,401,557 L639P probably damaging Het
Psmc3 G T 2: 91,054,630 R47L probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sesn2 A G 4: 132,502,570 V50A probably benign Het
Slc6a16 G A 7: 45,261,148 G377S probably damaging Het
Slitrk1 A G 14: 108,912,022 F419S probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Spata31d1a T A 13: 59,706,320 probably benign Homo
Tgoln1 A T 6: 72,616,001 D165E possibly damaging Het
Tmprss15 T A 16: 79,024,378 T492S probably benign Het
Ttc37 C T 13: 76,118,291 T219M probably benign Het
Zc3h13 T A 14: 75,337,409 M1565K probably damaging Het
Zcwpw1 T C 5: 137,812,036 V358A possibly damaging Het
Zfp607a A G 7: 27,878,582 H359R probably damaging Het
Zzef1 T A 11: 72,855,383 V837E probably damaging Het
Other mutations in Olfr813
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Olfr813 APN 10 129856628 missense probably benign 0.00
IGL01650:Olfr813 APN 10 129857067 missense probably damaging 1.00
IGL01734:Olfr813 APN 10 129856802 missense probably benign 0.36
IGL01909:Olfr813 APN 10 129857081 missense probably damaging 0.99
R0256:Olfr813 UTSW 10 129857037 missense probably damaging 1.00
R0607:Olfr813 UTSW 10 129857201 missense possibly damaging 0.67
R0924:Olfr813 UTSW 10 129856646 missense probably damaging 1.00
R1345:Olfr813 UTSW 10 129856890 missense probably damaging 1.00
R1462:Olfr813 UTSW 10 129857231 missense probably damaging 0.98
R1462:Olfr813 UTSW 10 129857231 missense probably damaging 0.98
R2344:Olfr813 UTSW 10 129856541 missense probably benign 0.01
R3851:Olfr813 UTSW 10 129857147 missense probably benign 0.00
R4486:Olfr813 UTSW 10 129856698 missense probably damaging 1.00
R4934:Olfr813 UTSW 10 129857027 missense possibly damaging 0.91
R5397:Olfr813 UTSW 10 129856710 missense probably damaging 1.00
R5644:Olfr813 UTSW 10 129857427 missense probably benign 0.38
R5925:Olfr813 UTSW 10 129856875 missense probably damaging 1.00
R7839:Olfr813 UTSW 10 129857030 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GGCCATGGGTTTAGAGCTAG -3'
(R):5'- CACCTGCTGGTTCCTTAAAGTG -3'

Sequencing Primer
(F):5'- GAGCTAGATTTCTGTGACTCCAAC -3'
(R):5'- GGATTCAGCATGGGAGCAAC -3'
Posted On2018-02-28