Incidental Mutation 'R6224:Gspt1'
ID504222
Institutional Source Beutler Lab
Gene Symbol Gspt1
Ensembl Gene ENSMUSG00000062203
Gene NameG1 to S phase transition 1
SynonymsGst-1, G1st, Gst-1
MMRRC Submission 044355-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6224 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location11219292-11254325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11224542 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 493 (V493L)
Ref Sequence ENSEMBL: ENSMUSP00000078940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080030] [ENSMUST00000167571]
PDB Structure
Structure of GSPT1/ERF3A-PABC [SOLUTION NMR]
Structure of GSPT1/ERF3A-PABC [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000080030
AA Change: V493L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000078940
Gene: ENSMUSG00000062203
AA Change: V493L

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
Pfam:PAM2 64 81 4.3e-8 PFAM
low complexity region 101 116 N/A INTRINSIC
low complexity region 151 193 N/A INTRINSIC
Pfam:GTP_EFTU 209 482 3.1e-47 PFAM
Pfam:GTP_EFTU_D2 451 518 1.2e-8 PFAM
Pfam:GTP_EFTU_D3 524 632 7.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164098
Predicted Effect probably benign
Transcript: ENSMUST00000167025
SMART Domains Protein: ENSMUSP00000130959
Gene: ENSMUSG00000062203

DomainStartEndE-ValueType
Pfam:GTP_EFTU_D3 18 96 2.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167571
AA Change: V492L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130583
Gene: ENSMUSG00000062203
AA Change: V492L

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 35 49 N/A INTRINSIC
Pfam:PAM2 64 81 7.1e-8 PFAM
low complexity region 101 116 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
Pfam:GTP_EFTU 208 476 4.3e-49 PFAM
Pfam:GTP_EFTU_D2 450 517 1.3e-7 PFAM
Pfam:GTP_EFTU_D3 523 631 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230245
Meta Mutation Damage Score 0.2700 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A C 11: 99,838,014 M1R probably null Het
4930505A04Rik A C 11: 30,454,815 N29K probably benign Het
Adamtsl4 T C 3: 95,681,729 Y464C probably damaging Het
Asgr2 T C 11: 70,098,246 V172A probably damaging Het
Atad1 T C 19: 32,698,628 Y132C probably damaging Het
Bpifa6 G A 2: 153,987,153 R200H probably damaging Het
Brd1 A T 15: 88,688,355 M1171K possibly damaging Het
Cadm2 A T 16: 66,664,395 L392Q probably damaging Het
Ccdc183 C T 2: 25,610,582 E333K possibly damaging Het
Cenpe T C 3: 135,243,775 I1335T possibly damaging Het
Cpxm2 T C 7: 132,143,731 N122D probably benign Het
Crls1 T A 2: 132,849,850 probably null Het
Cyp46a1 T C 12: 108,361,560 F460S probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcps T A 9: 35,136,481 T128S probably benign Het
Dcun1d3 A T 7: 119,859,491 L107* probably null Het
Eml1 T C 12: 108,514,508 F397S probably damaging Het
Fanca T A 8: 123,305,281 H348L possibly damaging Het
Foxo1 T A 3: 52,345,672 S419T probably benign Het
Gli3 T C 13: 15,725,145 V1039A probably benign Het
Gm5741 A T 8: 85,067,591 *73R probably null Het
Gp6 A T 7: 4,394,212 F75I probably benign Het
Gpha2 T A 19: 6,227,112 I81N possibly damaging Het
Igsf10 C A 3: 59,325,510 C1934F probably damaging Het
Irgm1 T C 11: 48,866,886 T49A probably benign Het
Klc4 A G 17: 46,640,062 I207T possibly damaging Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Lama1 T C 17: 67,802,987 V2201A possibly damaging Het
Lilrb4a T A 10: 51,491,649 Y96N probably damaging Het
Lrfn2 A G 17: 49,096,351 T501A probably damaging Het
Lrriq1 A G 10: 103,215,757 I378T probably damaging Het
Mphosph8 T C 14: 56,668,353 M1T probably null Het
Nsd1 T C 13: 55,313,132 S2391P possibly damaging Het
Ogdhl G A 14: 32,342,061 G647D probably benign Het
Olfr480 T C 7: 108,066,742 I19V probably benign Het
Olfr813 A G 10: 129,857,192 K225E probably benign Het
Pbrm1 T A 14: 31,050,111 H387Q probably benign Het
Pdgfrb C A 18: 61,081,939 Y1013* probably null Het
Pitrm1 T C 13: 6,565,054 V562A probably damaging Het
Pnpla8 T C 12: 44,283,028 V121A possibly damaging Het
Psd4 T C 2: 24,401,557 L639P probably damaging Het
Psmc3 G T 2: 91,054,630 R47L probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sesn2 A G 4: 132,502,570 V50A probably benign Het
Slc6a16 G A 7: 45,261,148 G377S probably damaging Het
Slitrk1 A G 14: 108,912,022 F419S probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Spata31d1a T A 13: 59,706,320 probably benign Homo
Tgoln1 A T 6: 72,616,001 D165E possibly damaging Het
Tmprss15 T A 16: 79,024,378 T492S probably benign Het
Ttc37 C T 13: 76,118,291 T219M probably benign Het
Zc3h13 T A 14: 75,337,409 M1565K probably damaging Het
Zcwpw1 T C 5: 137,812,036 V358A possibly damaging Het
Zfp607a A G 7: 27,878,582 H359R probably damaging Het
Zzef1 T A 11: 72,855,383 V837E probably damaging Het
Other mutations in Gspt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Gspt1 APN 16 11222612 missense probably damaging 0.99
IGL00902:Gspt1 APN 16 11232579 missense probably damaging 1.00
IGL00983:Gspt1 APN 16 11230997 splice site probably benign
IGL01775:Gspt1 APN 16 11223295 missense possibly damaging 0.92
IGL02079:Gspt1 APN 16 11240829 missense probably benign 0.17
IGL02122:Gspt1 APN 16 11229216 missense probably damaging 1.00
IGL02525:Gspt1 APN 16 11230990 missense probably damaging 1.00
IGL03092:Gspt1 APN 16 11238899 missense probably benign 0.11
goliad UTSW 16 11224542 missense probably benign 0.04
R0835:Gspt1 UTSW 16 11238938 missense probably benign
R1519:Gspt1 UTSW 16 11220855 missense probably damaging 1.00
R3410:Gspt1 UTSW 16 11229245 missense probably damaging 1.00
R4834:Gspt1 UTSW 16 11222717 missense probably damaging 1.00
R4866:Gspt1 UTSW 16 11222665 missense possibly damaging 0.69
R5121:Gspt1 UTSW 16 11223301 missense probably damaging 0.99
R5408:Gspt1 UTSW 16 11253855 missense probably benign
R5410:Gspt1 UTSW 16 11230510 missense probably benign 0.00
R5517:Gspt1 UTSW 16 11253979 missense unknown
R5704:Gspt1 UTSW 16 11228193 missense possibly damaging 0.89
R6317:Gspt1 UTSW 16 11223208 splice site probably null
R7069:Gspt1 UTSW 16 11222661 missense probably damaging 1.00
R7151:Gspt1 UTSW 16 11253828 missense probably benign 0.05
R7317:Gspt1 UTSW 16 11222657 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACTCAGGACAAAGGCACTG -3'
(R):5'- GTCTGACAAGCCAAGATTGAC -3'

Sequencing Primer
(F):5'- CTCAGGACAAAGGCACTGAAATTAAG -3'
(R):5'- AGCCAAGATTGACCCCCTTTC -3'
Posted On2018-02-28