Incidental Mutation 'R6225:Chia1'
ID504246
Institutional Source Beutler Lab
Gene Symbol Chia1
Ensembl Gene ENSMUSG00000062778
Gene Namechitinase, acidic 1
Synonyms2200003E03Rik, YNL, AMCase, Chia
MMRRC Submission 044356-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R6225 (G1)
Quality Score193.009
Status Validated
Chromosome3
Chromosomal Location106113229-106132120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106130897 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 370 (S370P)
Ref Sequence ENSEMBL: ENSMUSP00000078134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079132] [ENSMUST00000139086]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079132
AA Change: S370P

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078134
Gene: ENSMUSG00000062778
AA Change: S370P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.82e-161 SMART
ChtBD2 425 473 2.06e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139086
SMART Domains Protein: ENSMUSP00000121967
Gene: ENSMUSG00000062778

DomainStartEndE-ValueType
Glyco_18 3 215 2.24e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143128
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene degrades chitin, which is found in the cell wall of most fungi as well as in arthropods and some nematodes. The encoded protein can also stimulate interleukin 13 expression, and variations in this gene can lead to asthma susceptibility. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,948,304 V1466A probably damaging Het
Ace A G 11: 105,979,619 H288R possibly damaging Het
Adh1 T C 3: 138,289,804 F323L probably benign Het
Adssl1 A C 12: 112,634,403 H226P probably damaging Het
Ahrr A G 13: 74,222,912 S230P possibly damaging Het
Akap9 T C 5: 3,962,105 V936A probably damaging Het
B4galnt2 A G 11: 95,868,442 Y339H probably damaging Het
C4b C A 17: 34,738,874 G611V possibly damaging Het
Cacna1i A G 15: 80,321,226 M128V probably damaging Het
Cops6 T C 5: 138,161,411 V9A possibly damaging Het
D3Ertd254e T C 3: 36,166,203 F792L probably benign Het
D630003M21Rik A T 2: 158,217,401 I193K probably benign Het
Daam2 T C 17: 49,494,439 D90G probably damaging Het
Fads3 A G 19: 10,041,838 D36G probably benign Het
Fam185a T C 5: 21,425,556 V130A probably damaging Het
Fbn1 A T 2: 125,330,543 N1928K probably damaging Het
Fstl3 A G 10: 79,780,009 M110V probably benign Het
G2e3 A G 12: 51,369,136 T552A possibly damaging Het
Gfra1 G A 19: 58,238,398 T462I probably damaging Het
Glrx2 T A 1: 143,745,383 probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Gm43302 T A 5: 105,277,739 K275* probably null Het
Gm6569 A G 15: 73,839,791 probably benign Het
Herc6 G T 6: 57,662,154 V867L possibly damaging Het
Hhipl2 T A 1: 183,428,551 probably null Het
Kcnj16 A T 11: 111,025,552 K347* probably null Het
Kcnt2 T A 1: 140,426,923 C305* probably null Het
Large2 A G 2: 92,366,480 L477P probably damaging Het
Lnpep T C 17: 17,578,983 T137A possibly damaging Het
Mettl3 T C 14: 52,296,758 probably null Het
Mical3 C T 6: 120,958,723 S1614N probably damaging Het
Morc3 C A 16: 93,845,194 Y100* probably null Het
Mrc2 A G 11: 105,346,820 K1108R probably benign Het
Mrpl2 T C 17: 46,649,909 V243A probably damaging Het
Mtor T A 4: 148,521,337 N1505K probably benign Het
Mut T A 17: 40,938,731 V199E possibly damaging Het
Myo1g A T 11: 6,519,168 Y45N probably damaging Het
Nckap5l C A 15: 99,428,024 L199F possibly damaging Het
Ndufc2 A G 7: 97,406,892 T66A probably damaging Het
Nos1 T A 5: 117,912,852 H779Q probably damaging Het
Olfr1148 A G 2: 87,833,317 T93A probably benign Het
Olfr1264 A G 2: 90,021,229 probably null Het
Olfr180 T C 16: 58,916,182 N153S probably benign Het
Olfr221 C A 14: 52,035,368 V248L possibly damaging Het
Olfr382 T C 11: 73,517,005 N65D probably damaging Het
Olfr615 A T 7: 103,561,282 R268S probably benign Het
Olfr71 T C 4: 43,705,698 Y290C probably damaging Het
Otog C T 7: 46,249,034 T192I possibly damaging Het
Oxct1 T C 15: 4,035,330 V50A probably benign Het
P3h2 T A 16: 25,965,743 D667V probably damaging Het
Pcdhb20 A G 18: 37,504,994 Y191C probably damaging Het
Pds5b T G 5: 150,746,618 V357G probably damaging Het
Pggt1b A G 18: 46,274,607 V81A possibly damaging Het
Phxr2 A G 10: 99,126,181 probably benign Het
Pnpt1 T C 11: 29,145,469 I406T probably benign Het
Ppat T C 5: 76,922,355 I173V probably damaging Het
Proser3 T C 7: 30,543,728 S167G probably damaging Het
Rnf135 A C 11: 80,189,227 T115P possibly damaging Het
Rpl22 C T 4: 152,330,079 R65C probably benign Het
Scel T C 14: 103,591,984 F405L probably benign Het
Serinc3 A G 2: 163,627,879 Y350H probably damaging Het
Slc25a16 C A 10: 62,928,323 T53K probably damaging Het
Slco1a1 A T 6: 141,924,489 F308I possibly damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smok3c T C 5: 138,065,052 V267A probably benign Het
Ssrp1 A G 2: 85,042,814 D473G probably benign Het
Svs6 A G 2: 164,317,485 E56G possibly damaging Het
Tas2r130 TCATTTC T 6: 131,630,584 probably benign Het
Thoc3 T C 13: 54,467,972 N93S probably benign Het
Tle6 A G 10: 81,592,766 C443R probably damaging Het
Tmed6 A G 8: 107,061,739 F192S probably damaging Het
Tpx2 A G 2: 152,876,628 N184D probably benign Het
Vmn2r31 T A 7: 7,394,639 N207Y probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp972 A T 2: 177,907,324 probably null Het
Zzef1 G A 11: 72,869,805 C1318Y possibly damaging Het
Other mutations in Chia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01917:Chia1 APN 3 106128220 missense probably damaging 1.00
R0004:Chia1 UTSW 3 106129009 missense probably damaging 1.00
R0011:Chia1 UTSW 3 106130974 unclassified probably benign
R0047:Chia1 UTSW 3 106115257 missense probably damaging 0.99
R0345:Chia1 UTSW 3 106122439 missense probably damaging 1.00
R0456:Chia1 UTSW 3 106128479 missense probably damaging 1.00
R0638:Chia1 UTSW 3 106128437 splice site probably benign
R0847:Chia1 UTSW 3 106131937 missense probably benign 0.12
R1055:Chia1 UTSW 3 106130883 missense probably damaging 1.00
R1401:Chia1 UTSW 3 106128939 missense probably benign 0.00
R1513:Chia1 UTSW 3 106131904 missense probably benign 0.44
R1846:Chia1 UTSW 3 106130865 missense probably damaging 0.98
R1882:Chia1 UTSW 3 106128474 missense probably damaging 1.00
R1914:Chia1 UTSW 3 106128559 missense probably benign 0.06
R1915:Chia1 UTSW 3 106128559 missense probably benign 0.06
R2107:Chia1 UTSW 3 106128840 nonsense probably null
R3969:Chia1 UTSW 3 106121635 splice site probably null
R3970:Chia1 UTSW 3 106121635 splice site probably null
R4112:Chia1 UTSW 3 106128528 missense probably damaging 1.00
R4432:Chia1 UTSW 3 106115325 missense probably benign 0.03
R4625:Chia1 UTSW 3 106128940 missense probably benign 0.00
R4748:Chia1 UTSW 3 106122449 missense probably damaging 1.00
R5805:Chia1 UTSW 3 106128476 missense probably damaging 0.98
R5906:Chia1 UTSW 3 106131988 missense probably benign 0.01
R6173:Chia1 UTSW 3 106129022 critical splice donor site probably null
R6214:Chia1 UTSW 3 106122445 missense probably damaging 1.00
R6215:Chia1 UTSW 3 106122445 missense probably damaging 1.00
R6383:Chia1 UTSW 3 106131811 missense probably benign
R6423:Chia1 UTSW 3 106128988 missense possibly damaging 0.60
R6668:Chia1 UTSW 3 106130948 missense probably damaging 1.00
R6764:Chia1 UTSW 3 106130740 critical splice donor site probably null
R7030:Chia1 UTSW 3 106115325 missense probably damaging 1.00
R7221:Chia1 UTSW 3 106131920 missense probably damaging 1.00
R7265:Chia1 UTSW 3 106128923 missense probably damaging 1.00
R7343:Chia1 UTSW 3 106132015 makesense probably null
R7420:Chia1 UTSW 3 106130664 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTGTTAAGGTAAGGCCAGC -3'
(R):5'- CCTGGACAAGTGCAACAGACTG -3'

Sequencing Primer
(F):5'- TAAGGTAAGGCCAGCTCCTTG -3'
(R):5'- TGAGAATGCCAAGACTGCC -3'
Posted On2018-02-28