Incidental Mutation 'R6225:Olfr615'
ID504267
Institutional Source Beutler Lab
Gene Symbol Olfr615
Ensembl Gene ENSMUSG00000073947
Gene Nameolfactory receptor 615
SynonymsGA_x6K02T2PBJ9-6284902-6285843, MOR19-2
MMRRC Submission 044356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6225 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103556079-103563798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103561282 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 268 (R268S)
Ref Sequence ENSEMBL: ENSMUSP00000150166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098198] [ENSMUST00000106886] [ENSMUST00000214345] [ENSMUST00000214806] [ENSMUST00000215673] [ENSMUST00000217293]
Predicted Effect probably benign
Transcript: ENSMUST00000098198
AA Change: R268S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000095800
Gene: ENSMUSG00000073947
AA Change: R268S

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-105 PFAM
Pfam:7TM_GPCR_Srsx 36 253 8.5e-9 PFAM
Pfam:7tm_1 42 293 8.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106886
SMART Domains Protein: ENSMUSP00000102499
Gene: ENSMUSG00000047544

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:7tm_4 33 311 1.1e-116 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.2e-6 PFAM
Pfam:7tm_1 43 294 4.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214345
AA Change: R268S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000214806
Predicted Effect probably benign
Transcript: ENSMUST00000215673
AA Change: R268S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000217293
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,948,304 V1466A probably damaging Het
Ace A G 11: 105,979,619 H288R possibly damaging Het
Adh1 T C 3: 138,289,804 F323L probably benign Het
Adssl1 A C 12: 112,634,403 H226P probably damaging Het
Ahrr A G 13: 74,222,912 S230P possibly damaging Het
Akap9 T C 5: 3,962,105 V936A probably damaging Het
B4galnt2 A G 11: 95,868,442 Y339H probably damaging Het
C4b C A 17: 34,738,874 G611V possibly damaging Het
Cacna1i A G 15: 80,321,226 M128V probably damaging Het
Chia1 T C 3: 106,130,897 S370P possibly damaging Het
Cops6 T C 5: 138,161,411 V9A possibly damaging Het
D3Ertd254e T C 3: 36,166,203 F792L probably benign Het
D630003M21Rik A T 2: 158,217,401 I193K probably benign Het
Daam2 T C 17: 49,494,439 D90G probably damaging Het
Fads3 A G 19: 10,041,838 D36G probably benign Het
Fam185a T C 5: 21,425,556 V130A probably damaging Het
Fbn1 A T 2: 125,330,543 N1928K probably damaging Het
Fstl3 A G 10: 79,780,009 M110V probably benign Het
G2e3 A G 12: 51,369,136 T552A possibly damaging Het
Gfra1 G A 19: 58,238,398 T462I probably damaging Het
Glrx2 T A 1: 143,745,383 probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Gm43302 T A 5: 105,277,739 K275* probably null Het
Gm6569 A G 15: 73,839,791 probably benign Het
Herc6 G T 6: 57,662,154 V867L possibly damaging Het
Hhipl2 T A 1: 183,428,551 probably null Het
Kcnj16 A T 11: 111,025,552 K347* probably null Het
Kcnt2 T A 1: 140,426,923 C305* probably null Het
Large2 A G 2: 92,366,480 L477P probably damaging Het
Lnpep T C 17: 17,578,983 T137A possibly damaging Het
Mettl3 T C 14: 52,296,758 probably null Het
Mical3 C T 6: 120,958,723 S1614N probably damaging Het
Morc3 C A 16: 93,845,194 Y100* probably null Het
Mrc2 A G 11: 105,346,820 K1108R probably benign Het
Mrpl2 T C 17: 46,649,909 V243A probably damaging Het
Mtor T A 4: 148,521,337 N1505K probably benign Het
Mut T A 17: 40,938,731 V199E possibly damaging Het
Myo1g A T 11: 6,519,168 Y45N probably damaging Het
Nckap5l C A 15: 99,428,024 L199F possibly damaging Het
Ndufc2 A G 7: 97,406,892 T66A probably damaging Het
Nos1 T A 5: 117,912,852 H779Q probably damaging Het
Olfr1148 A G 2: 87,833,317 T93A probably benign Het
Olfr1264 A G 2: 90,021,229 probably null Het
Olfr180 T C 16: 58,916,182 N153S probably benign Het
Olfr221 C A 14: 52,035,368 V248L possibly damaging Het
Olfr382 T C 11: 73,517,005 N65D probably damaging Het
Olfr71 T C 4: 43,705,698 Y290C probably damaging Het
Otog C T 7: 46,249,034 T192I possibly damaging Het
Oxct1 T C 15: 4,035,330 V50A probably benign Het
P3h2 T A 16: 25,965,743 D667V probably damaging Het
Pcdhb20 A G 18: 37,504,994 Y191C probably damaging Het
Pds5b T G 5: 150,746,618 V357G probably damaging Het
Pggt1b A G 18: 46,274,607 V81A possibly damaging Het
Phxr2 A G 10: 99,126,181 probably benign Het
Pnpt1 T C 11: 29,145,469 I406T probably benign Het
Ppat T C 5: 76,922,355 I173V probably damaging Het
Proser3 T C 7: 30,543,728 S167G probably damaging Het
Rnf135 A C 11: 80,189,227 T115P possibly damaging Het
Rpl22 C T 4: 152,330,079 R65C probably benign Het
Scel T C 14: 103,591,984 F405L probably benign Het
Serinc3 A G 2: 163,627,879 Y350H probably damaging Het
Slc25a16 C A 10: 62,928,323 T53K probably damaging Het
Slco1a1 A T 6: 141,924,489 F308I possibly damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smok3c T C 5: 138,065,052 V267A probably benign Het
Ssrp1 A G 2: 85,042,814 D473G probably benign Het
Svs6 A G 2: 164,317,485 E56G possibly damaging Het
Tas2r130 TCATTTC T 6: 131,630,584 probably benign Het
Thoc3 T C 13: 54,467,972 N93S probably benign Het
Tle6 A G 10: 81,592,766 C443R probably damaging Het
Tmed6 A G 8: 107,061,739 F192S probably damaging Het
Tpx2 A G 2: 152,876,628 N184D probably benign Het
Vmn2r31 T A 7: 7,394,639 N207Y probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp972 A T 2: 177,907,324 probably null Het
Zzef1 G A 11: 72,869,805 C1318Y possibly damaging Het
Other mutations in Olfr615
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Olfr615 APN 7 103561356 missense probably damaging 1.00
IGL01310:Olfr615 APN 7 103560801 missense probably benign
IGL01597:Olfr615 APN 7 103561142 missense possibly damaging 0.79
IGL01725:Olfr615 APN 7 103561075 nonsense probably null
IGL03291:Olfr615 APN 7 103560912 missense possibly damaging 0.93
R0055:Olfr615 UTSW 7 103561037 missense probably damaging 1.00
R0055:Olfr615 UTSW 7 103561037 missense probably damaging 1.00
R0189:Olfr615 UTSW 7 103561082 missense probably benign 0.01
R0254:Olfr615 UTSW 7 103560622 nonsense probably null
R1395:Olfr615 UTSW 7 103561119 missense possibly damaging 0.92
R1781:Olfr615 UTSW 7 103560566 missense probably benign 0.34
R2866:Olfr615 UTSW 7 103560857 missense probably damaging 1.00
R2958:Olfr615 UTSW 7 103561305 missense possibly damaging 0.54
R3922:Olfr615 UTSW 7 103560705 missense probably benign 0.00
R4306:Olfr615 UTSW 7 103561172 nonsense probably null
R4306:Olfr615 UTSW 7 103561173 missense possibly damaging 0.50
R4818:Olfr615 UTSW 7 103560761 missense probably benign 0.07
R4907:Olfr615 UTSW 7 103561034 missense possibly damaging 0.85
R4993:Olfr615 UTSW 7 103561317 missense possibly damaging 0.63
R5461:Olfr615 UTSW 7 103560573 missense probably damaging 1.00
R6621:Olfr615 UTSW 7 103560878 missense possibly damaging 0.93
R7174:Olfr615 UTSW 7 103561391 nonsense probably null
R7665:Olfr615 UTSW 7 103561316 missense probably benign 0.00
R7684:Olfr615 UTSW 7 103561218 missense probably benign 0.01
Z1088:Olfr615 UTSW 7 103561059 missense probably benign
Z1088:Olfr615 UTSW 7 103561390 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTGTGGCCAAGTCAAGATC -3'
(R):5'- CACTGTTTAGTTAGCAAAGTGCATC -3'

Sequencing Primer
(F):5'- GTGGCCAAGTCAAGATCAATATTTTC -3'
(R):5'- ACAATCATGTGTACGGTGAAATTG -3'
Posted On2018-02-28