Incidental Mutation 'R6225:Adssl1'
ID504285
Institutional Source Beutler Lab
Gene Symbol Adssl1
Ensembl Gene ENSMUSG00000011148
Gene Nameadenylosuccinate synthetase like 1
SynonymsAdss
MMRRC Submission 044356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R6225 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location112620045-112641360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 112634403 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 226 (H226P)
Ref Sequence ENSEMBL: ENSMUSP00000136572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021726] [ENSMUST00000180015]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021726
AA Change: H203P

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021726
Gene: ENSMUSG00000011148
AA Change: H203P

DomainStartEndE-ValueType
Adenylsucc_synt 33 455 5.9e-259 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180015
AA Change: H226P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136572
Gene: ENSMUSG00000011148
AA Change: H226P

DomainStartEndE-ValueType
Adenylsucc_synt 33 478 2.17e-248 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223044
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylosuccinate synthase family of proteins. The encoded muscle-specific enzyme plays a role in the purine nucleotide cycle by catalyzing the first step in the conversion of inosine monophosphate (IMP) to adenosine monophosphate (AMP). Mutations in this gene may cause adolescent onset distal myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,948,304 V1466A probably damaging Het
Ace A G 11: 105,979,619 H288R possibly damaging Het
Adh1 T C 3: 138,289,804 F323L probably benign Het
Ahrr A G 13: 74,222,912 S230P possibly damaging Het
Akap9 T C 5: 3,962,105 V936A probably damaging Het
B4galnt2 A G 11: 95,868,442 Y339H probably damaging Het
C4b C A 17: 34,738,874 G611V possibly damaging Het
Cacna1i A G 15: 80,321,226 M128V probably damaging Het
Chia1 T C 3: 106,130,897 S370P possibly damaging Het
Cops6 T C 5: 138,161,411 V9A possibly damaging Het
D3Ertd254e T C 3: 36,166,203 F792L probably benign Het
D630003M21Rik A T 2: 158,217,401 I193K probably benign Het
Daam2 T C 17: 49,494,439 D90G probably damaging Het
Fads3 A G 19: 10,041,838 D36G probably benign Het
Fam185a T C 5: 21,425,556 V130A probably damaging Het
Fbn1 A T 2: 125,330,543 N1928K probably damaging Het
Fstl3 A G 10: 79,780,009 M110V probably benign Het
G2e3 A G 12: 51,369,136 T552A possibly damaging Het
Gfra1 G A 19: 58,238,398 T462I probably damaging Het
Glrx2 T A 1: 143,745,383 probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Gm43302 T A 5: 105,277,739 K275* probably null Het
Gm6569 A G 15: 73,839,791 probably benign Het
Herc6 G T 6: 57,662,154 V867L possibly damaging Het
Hhipl2 T A 1: 183,428,551 probably null Het
Kcnj16 A T 11: 111,025,552 K347* probably null Het
Kcnt2 T A 1: 140,426,923 C305* probably null Het
Large2 A G 2: 92,366,480 L477P probably damaging Het
Lnpep T C 17: 17,578,983 T137A possibly damaging Het
Mettl3 T C 14: 52,296,758 probably null Het
Mical3 C T 6: 120,958,723 S1614N probably damaging Het
Morc3 C A 16: 93,845,194 Y100* probably null Het
Mrc2 A G 11: 105,346,820 K1108R probably benign Het
Mrpl2 T C 17: 46,649,909 V243A probably damaging Het
Mtor T A 4: 148,521,337 N1505K probably benign Het
Mut T A 17: 40,938,731 V199E possibly damaging Het
Myo1g A T 11: 6,519,168 Y45N probably damaging Het
Nckap5l C A 15: 99,428,024 L199F possibly damaging Het
Ndufc2 A G 7: 97,406,892 T66A probably damaging Het
Nos1 T A 5: 117,912,852 H779Q probably damaging Het
Olfr1148 A G 2: 87,833,317 T93A probably benign Het
Olfr1264 A G 2: 90,021,229 probably null Het
Olfr180 T C 16: 58,916,182 N153S probably benign Het
Olfr221 C A 14: 52,035,368 V248L possibly damaging Het
Olfr382 T C 11: 73,517,005 N65D probably damaging Het
Olfr615 A T 7: 103,561,282 R268S probably benign Het
Olfr71 T C 4: 43,705,698 Y290C probably damaging Het
Otog C T 7: 46,249,034 T192I possibly damaging Het
Oxct1 T C 15: 4,035,330 V50A probably benign Het
P3h2 T A 16: 25,965,743 D667V probably damaging Het
Pcdhb20 A G 18: 37,504,994 Y191C probably damaging Het
Pds5b T G 5: 150,746,618 V357G probably damaging Het
Pggt1b A G 18: 46,274,607 V81A possibly damaging Het
Phxr2 A G 10: 99,126,181 probably benign Het
Pnpt1 T C 11: 29,145,469 I406T probably benign Het
Ppat T C 5: 76,922,355 I173V probably damaging Het
Proser3 T C 7: 30,543,728 S167G probably damaging Het
Rnf135 A C 11: 80,189,227 T115P possibly damaging Het
Rpl22 C T 4: 152,330,079 R65C probably benign Het
Scel T C 14: 103,591,984 F405L probably benign Het
Serinc3 A G 2: 163,627,879 Y350H probably damaging Het
Slc25a16 C A 10: 62,928,323 T53K probably damaging Het
Slco1a1 A T 6: 141,924,489 F308I possibly damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smok3c T C 5: 138,065,052 V267A probably benign Het
Ssrp1 A G 2: 85,042,814 D473G probably benign Het
Svs6 A G 2: 164,317,485 E56G possibly damaging Het
Tas2r130 TCATTTC T 6: 131,630,584 probably benign Het
Thoc3 T C 13: 54,467,972 N93S probably benign Het
Tle6 A G 10: 81,592,766 C443R probably damaging Het
Tmed6 A G 8: 107,061,739 F192S probably damaging Het
Tpx2 A G 2: 152,876,628 N184D probably benign Het
Vmn2r31 T A 7: 7,394,639 N207Y probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp972 A T 2: 177,907,324 probably null Het
Zzef1 G A 11: 72,869,805 C1318Y possibly damaging Het
Other mutations in Adssl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Adssl1 APN 12 112634736 splice site probably benign
IGL03105:Adssl1 APN 12 112632721 missense probably benign 0.00
barty UTSW 12 112634189 missense probably damaging 1.00
lannister UTSW 12 112634713 missense probably damaging 1.00
R0179:Adssl1 UTSW 12 112632269 missense probably benign 0.11
R1722:Adssl1 UTSW 12 112636481 missense possibly damaging 0.93
R1911:Adssl1 UTSW 12 112633009 missense probably benign
R2877:Adssl1 UTSW 12 112634189 missense probably damaging 1.00
R4829:Adssl1 UTSW 12 112634713 missense probably damaging 1.00
R5155:Adssl1 UTSW 12 112638208 missense probably damaging 1.00
R6247:Adssl1 UTSW 12 112628356 missense probably damaging 1.00
R6873:Adssl1 UTSW 12 112632704 missense probably benign 0.00
R7012:Adssl1 UTSW 12 112634236 missense probably benign 0.01
R7449:Adssl1 UTSW 12 112634151 missense probably damaging 1.00
R7662:Adssl1 UTSW 12 112639738 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGAGTTTTCTGCCAGGTAGG -3'
(R):5'- ATCTCGAACCATGGGTCTGATG -3'

Sequencing Primer
(F):5'- TTCTGCCAGGTAGGTCTGCC -3'
(R):5'- TGAGAGGACCGTGCAACCAC -3'
Posted On2018-02-28