Incidental Mutation 'R6225:Scel'
ID504290
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Namesciellin
Synonyms9230114I02Rik
MMRRC Submission 044356-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6225 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location103513342-103612797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103591984 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 405 (F405L)
Ref Sequence ENSEMBL: ENSMUSP00000154402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
Predicted Effect probably benign
Transcript: ENSMUST00000095576
AA Change: F425L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: F425L

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
AA Change: F405L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,948,304 V1466A probably damaging Het
Ace A G 11: 105,979,619 H288R possibly damaging Het
Adh1 T C 3: 138,289,804 F323L probably benign Het
Adssl1 A C 12: 112,634,403 H226P probably damaging Het
Ahrr A G 13: 74,222,912 S230P possibly damaging Het
Akap9 T C 5: 3,962,105 V936A probably damaging Het
B4galnt2 A G 11: 95,868,442 Y339H probably damaging Het
C4b C A 17: 34,738,874 G611V possibly damaging Het
Cacna1i A G 15: 80,321,226 M128V probably damaging Het
Chia1 T C 3: 106,130,897 S370P possibly damaging Het
Cops6 T C 5: 138,161,411 V9A possibly damaging Het
D3Ertd254e T C 3: 36,166,203 F792L probably benign Het
D630003M21Rik A T 2: 158,217,401 I193K probably benign Het
Daam2 T C 17: 49,494,439 D90G probably damaging Het
Fads3 A G 19: 10,041,838 D36G probably benign Het
Fam185a T C 5: 21,425,556 V130A probably damaging Het
Fbn1 A T 2: 125,330,543 N1928K probably damaging Het
Fstl3 A G 10: 79,780,009 M110V probably benign Het
G2e3 A G 12: 51,369,136 T552A possibly damaging Het
Gfra1 G A 19: 58,238,398 T462I probably damaging Het
Glrx2 T A 1: 143,745,383 probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Gm43302 T A 5: 105,277,739 K275* probably null Het
Gm6569 A G 15: 73,839,791 probably benign Het
Herc6 G T 6: 57,662,154 V867L possibly damaging Het
Hhipl2 T A 1: 183,428,551 probably null Het
Kcnj16 A T 11: 111,025,552 K347* probably null Het
Kcnt2 T A 1: 140,426,923 C305* probably null Het
Large2 A G 2: 92,366,480 L477P probably damaging Het
Lnpep T C 17: 17,578,983 T137A possibly damaging Het
Mettl3 T C 14: 52,296,758 probably null Het
Mical3 C T 6: 120,958,723 S1614N probably damaging Het
Morc3 C A 16: 93,845,194 Y100* probably null Het
Mrc2 A G 11: 105,346,820 K1108R probably benign Het
Mrpl2 T C 17: 46,649,909 V243A probably damaging Het
Mtor T A 4: 148,521,337 N1505K probably benign Het
Mut T A 17: 40,938,731 V199E possibly damaging Het
Myo1g A T 11: 6,519,168 Y45N probably damaging Het
Nckap5l C A 15: 99,428,024 L199F possibly damaging Het
Ndufc2 A G 7: 97,406,892 T66A probably damaging Het
Nos1 T A 5: 117,912,852 H779Q probably damaging Het
Olfr1148 A G 2: 87,833,317 T93A probably benign Het
Olfr1264 A G 2: 90,021,229 probably null Het
Olfr180 T C 16: 58,916,182 N153S probably benign Het
Olfr221 C A 14: 52,035,368 V248L possibly damaging Het
Olfr382 T C 11: 73,517,005 N65D probably damaging Het
Olfr615 A T 7: 103,561,282 R268S probably benign Het
Olfr71 T C 4: 43,705,698 Y290C probably damaging Het
Otog C T 7: 46,249,034 T192I possibly damaging Het
Oxct1 T C 15: 4,035,330 V50A probably benign Het
P3h2 T A 16: 25,965,743 D667V probably damaging Het
Pcdhb20 A G 18: 37,504,994 Y191C probably damaging Het
Pds5b T G 5: 150,746,618 V357G probably damaging Het
Pggt1b A G 18: 46,274,607 V81A possibly damaging Het
Phxr2 A G 10: 99,126,181 probably benign Het
Pnpt1 T C 11: 29,145,469 I406T probably benign Het
Ppat T C 5: 76,922,355 I173V probably damaging Het
Proser3 T C 7: 30,543,728 S167G probably damaging Het
Rnf135 A C 11: 80,189,227 T115P possibly damaging Het
Rpl22 C T 4: 152,330,079 R65C probably benign Het
Serinc3 A G 2: 163,627,879 Y350H probably damaging Het
Slc25a16 C A 10: 62,928,323 T53K probably damaging Het
Slco1a1 A T 6: 141,924,489 F308I possibly damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smok3c T C 5: 138,065,052 V267A probably benign Het
Ssrp1 A G 2: 85,042,814 D473G probably benign Het
Svs6 A G 2: 164,317,485 E56G possibly damaging Het
Tas2r130 TCATTTC T 6: 131,630,584 probably benign Het
Thoc3 T C 13: 54,467,972 N93S probably benign Het
Tle6 A G 10: 81,592,766 C443R probably damaging Het
Tmed6 A G 8: 107,061,739 F192S probably damaging Het
Tpx2 A G 2: 152,876,628 N184D probably benign Het
Vmn2r31 T A 7: 7,394,639 N207Y probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp972 A T 2: 177,907,324 probably null Het
Zzef1 G A 11: 72,869,805 C1318Y possibly damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GCAGAGCAAGTTCTGAGCATAG -3'
(R):5'- TGGTGCTGTCTACATCATGG -3'

Sequencing Primer
(F):5'- AGCAAGTTCTGAGCATAGTTCGTC -3'
(R):5'- GCTGTCTACATCATGGTTTCTG -3'
Posted On2018-02-28