Incidental Mutation 'R6225:P3h2'
ID 504296
Institutional Source Beutler Lab
Gene Symbol P3h2
Ensembl Gene ENSMUSG00000038168
Gene Name prolyl 3-hydroxylase 2
Synonyms Leprel1
MMRRC Submission 044356-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6225 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 25959288-26105784 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25965743 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 667 (D667V)
Ref Sequence ENSEMBL: ENSMUSP00000038056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039990]
AlphaFold Q8CG71
Predicted Effect probably damaging
Transcript: ENSMUST00000039990
AA Change: D667V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: D667V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 27 36 N/A INTRINSIC
Pfam:TPR_2 42 73 2.5e-5 PFAM
low complexity region 81 104 N/A INTRINSIC
low complexity region 114 123 N/A INTRINSIC
Pfam:TPR_2 206 237 1.2e-5 PFAM
low complexity region 253 266 N/A INTRINSIC
internal_repeat_1 304 366 4.75e-7 PROSPERO
P4Hc 457 665 1.45e-51 SMART
Meta Mutation Damage Score 0.4841 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,948,304 V1466A probably damaging Het
Ace A G 11: 105,979,619 H288R possibly damaging Het
Adh1 T C 3: 138,289,804 F323L probably benign Het
Adssl1 A C 12: 112,634,403 H226P probably damaging Het
Ahrr A G 13: 74,222,912 S230P possibly damaging Het
Akap9 T C 5: 3,962,105 V936A probably damaging Het
B4galnt2 A G 11: 95,868,442 Y339H probably damaging Het
C4b C A 17: 34,738,874 G611V possibly damaging Het
Cacna1i A G 15: 80,321,226 M128V probably damaging Het
Chia1 T C 3: 106,130,897 S370P possibly damaging Het
Cops6 T C 5: 138,161,411 V9A possibly damaging Het
D3Ertd254e T C 3: 36,166,203 F792L probably benign Het
D630003M21Rik A T 2: 158,217,401 I193K probably benign Het
Daam2 T C 17: 49,494,439 D90G probably damaging Het
Fads3 A G 19: 10,041,838 D36G probably benign Het
Fam185a T C 5: 21,425,556 V130A probably damaging Het
Fbn1 A T 2: 125,330,543 N1928K probably damaging Het
Fstl3 A G 10: 79,780,009 M110V probably benign Het
G2e3 A G 12: 51,369,136 T552A possibly damaging Het
Gfra1 G A 19: 58,238,398 T462I probably damaging Het
Glrx2 T A 1: 143,745,383 probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Gm43302 T A 5: 105,277,739 K275* probably null Het
Gm6569 A G 15: 73,839,791 probably benign Het
Herc6 G T 6: 57,662,154 V867L possibly damaging Het
Hhipl2 T A 1: 183,428,551 probably null Het
Kcnj16 A T 11: 111,025,552 K347* probably null Het
Kcnt2 T A 1: 140,426,923 C305* probably null Het
Large2 A G 2: 92,366,480 L477P probably damaging Het
Lnpep T C 17: 17,578,983 T137A possibly damaging Het
Mettl3 T C 14: 52,296,758 probably null Het
Mical3 C T 6: 120,958,723 S1614N probably damaging Het
Morc3 C A 16: 93,845,194 Y100* probably null Het
Mrc2 A G 11: 105,346,820 K1108R probably benign Het
Mrpl2 T C 17: 46,649,909 V243A probably damaging Het
Mtor T A 4: 148,521,337 N1505K probably benign Het
Mut T A 17: 40,938,731 V199E possibly damaging Het
Myo1g A T 11: 6,519,168 Y45N probably damaging Het
Nckap5l C A 15: 99,428,024 L199F possibly damaging Het
Ndufc2 A G 7: 97,406,892 T66A probably damaging Het
Nos1 T A 5: 117,912,852 H779Q probably damaging Het
Olfr1148 A G 2: 87,833,317 T93A probably benign Het
Olfr1264 A G 2: 90,021,229 probably null Het
Olfr180 T C 16: 58,916,182 N153S probably benign Het
Olfr221 C A 14: 52,035,368 V248L possibly damaging Het
Olfr382 T C 11: 73,517,005 N65D probably damaging Het
Olfr615 A T 7: 103,561,282 R268S probably benign Het
Olfr71 T C 4: 43,705,698 Y290C probably damaging Het
Otog C T 7: 46,249,034 T192I possibly damaging Het
Oxct1 T C 15: 4,035,330 V50A probably benign Het
Pcdhb20 A G 18: 37,504,994 Y191C probably damaging Het
Pds5b T G 5: 150,746,618 V357G probably damaging Het
Pggt1b A G 18: 46,274,607 V81A possibly damaging Het
Phxr2 A G 10: 99,126,181 probably benign Het
Pnpt1 T C 11: 29,145,469 I406T probably benign Het
Ppat T C 5: 76,922,355 I173V probably damaging Het
Proser3 T C 7: 30,543,728 S167G probably damaging Het
Rnf135 A C 11: 80,189,227 T115P possibly damaging Het
Rpl22 C T 4: 152,330,079 R65C probably benign Het
Scel T C 14: 103,591,984 F405L probably benign Het
Serinc3 A G 2: 163,627,879 Y350H probably damaging Het
Slc25a16 C A 10: 62,928,323 T53K probably damaging Het
Slco1a1 A T 6: 141,924,489 F308I possibly damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smok3c T C 5: 138,065,052 V267A probably benign Het
Ssrp1 A G 2: 85,042,814 D473G probably benign Het
Svs6 A G 2: 164,317,485 E56G possibly damaging Het
Tas2r130 TCATTTC T 6: 131,630,584 probably benign Het
Thoc3 T C 13: 54,467,972 N93S probably benign Het
Tle6 A G 10: 81,592,766 C443R probably damaging Het
Tmed6 A G 8: 107,061,739 F192S probably damaging Het
Tpx2 A G 2: 152,876,628 N184D probably benign Het
Vmn2r31 T A 7: 7,394,639 N207Y probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp972 A T 2: 177,907,324 probably null Het
Zzef1 G A 11: 72,869,805 C1318Y possibly damaging Het
Other mutations in P3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:P3h2 APN 16 25992798 missense probably damaging 1.00
IGL01012:P3h2 APN 16 25987248 missense probably damaging 0.98
IGL02393:P3h2 APN 16 25992825 missense probably damaging 1.00
IGL02436:P3h2 APN 16 25997200 missense probably benign 0.01
PIT4445001:P3h2 UTSW 16 25984999 missense probably benign 0.01
R0319:P3h2 UTSW 16 25970931 missense possibly damaging 0.93
R0403:P3h2 UTSW 16 25969950 missense possibly damaging 0.63
R0962:P3h2 UTSW 16 25997248 missense probably benign
R1290:P3h2 UTSW 16 25987203 missense probably damaging 0.99
R1300:P3h2 UTSW 16 25997236 nonsense probably null
R1467:P3h2 UTSW 16 25965868 splice site probably benign
R1643:P3h2 UTSW 16 25972291 missense probably benign 0.00
R1645:P3h2 UTSW 16 25997232 missense probably damaging 1.00
R1761:P3h2 UTSW 16 25985050 missense probably damaging 0.96
R4227:P3h2 UTSW 16 26105453 missense probably benign
R4273:P3h2 UTSW 16 26105221 missense probably benign 0.00
R4409:P3h2 UTSW 16 26105290 missense possibly damaging 0.88
R4410:P3h2 UTSW 16 26105290 missense possibly damaging 0.88
R4653:P3h2 UTSW 16 26105277 missense probably damaging 0.98
R4968:P3h2 UTSW 16 25992662 critical splice donor site probably null
R5190:P3h2 UTSW 16 25984949 missense possibly damaging 0.86
R6113:P3h2 UTSW 16 25981153 missense probably benign 0.01
R6838:P3h2 UTSW 16 26105284 missense possibly damaging 0.73
R6881:P3h2 UTSW 16 25992745 missense probably damaging 1.00
R7089:P3h2 UTSW 16 25965809 missense probably damaging 1.00
R7445:P3h2 UTSW 16 25985065 missense probably damaging 0.96
R7753:P3h2 UTSW 16 25970937 missense probably damaging 1.00
R8166:P3h2 UTSW 16 25992822 missense possibly damaging 0.89
R8363:P3h2 UTSW 16 25992718 missense probably damaging 0.98
R8442:P3h2 UTSW 16 25987205 missense probably benign 0.05
R8812:P3h2 UTSW 16 25982717 missense possibly damaging 0.67
R8965:P3h2 UTSW 16 25972384 missense probably benign 0.41
R9187:P3h2 UTSW 16 26105436 missense probably benign 0.27
R9193:P3h2 UTSW 16 26105241 missense probably benign 0.07
R9533:P3h2 UTSW 16 25970975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACGAAGATGCGCTAGTGGATC -3'
(R):5'- TGAGGGGAGTAATCACACCG -3'

Sequencing Primer
(F):5'- CGAAGATGCGCTAGTGGATCTATTTC -3'
(R):5'- CGAAGGAATGATAGAAGGTCACGTG -3'
Posted On 2018-02-28