Incidental Mutation 'R6225:C4b'
ID 504300
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement C4B (Chido blood group)
Synonyms Ss, C4
MMRRC Submission 044356-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6225 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34947354-34962856 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34957848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 611 (G611V)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect possibly damaging
Transcript: ENSMUST00000069507
AA Change: G611V

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: G611V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (74/74)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,870,445 (GRCm39) H288R possibly damaging Het
Adh1 T C 3: 137,995,565 (GRCm39) F323L probably benign Het
Adss1 A C 12: 112,600,837 (GRCm39) H226P probably damaging Het
Ahrr A G 13: 74,371,031 (GRCm39) S230P possibly damaging Het
Akap9 T C 5: 4,012,105 (GRCm39) V936A probably damaging Het
B4galnt2 A G 11: 95,759,268 (GRCm39) Y339H probably damaging Het
Bltp1 T C 3: 37,002,453 (GRCm39) V1466A probably damaging Het
Cacna1i A G 15: 80,205,427 (GRCm39) M128V probably damaging Het
Chia1 T C 3: 106,038,213 (GRCm39) S370P possibly damaging Het
Cops6 T C 5: 138,159,673 (GRCm39) V9A possibly damaging Het
D630003M21Rik A T 2: 158,059,321 (GRCm39) I193K probably benign Het
Daam2 T C 17: 49,801,467 (GRCm39) D90G probably damaging Het
Fads3 A G 19: 10,019,202 (GRCm39) D36G probably benign Het
Fam185a T C 5: 21,630,554 (GRCm39) V130A probably damaging Het
Fbn1 A T 2: 125,172,463 (GRCm39) N1928K probably damaging Het
Fstl3 A G 10: 79,615,843 (GRCm39) M110V probably benign Het
G2e3 A G 12: 51,415,919 (GRCm39) T552A possibly damaging Het
Gfra1 G A 19: 58,226,830 (GRCm39) T462I probably damaging Het
Glrx2 T A 1: 143,621,121 (GRCm39) probably benign Het
Gm10100 G T 10: 77,562,498 (GRCm39) C60F possibly damaging Het
Gm43302 T A 5: 105,425,605 (GRCm39) K275* probably null Het
Gm6569 A G 15: 73,711,640 (GRCm39) probably benign Het
Herc6 G T 6: 57,639,139 (GRCm39) V867L possibly damaging Het
Hhipl2 T A 1: 183,209,459 (GRCm39) probably null Het
Kcnj16 A T 11: 110,916,378 (GRCm39) K347* probably null Het
Kcnt2 T A 1: 140,354,661 (GRCm39) C305* probably null Het
Large2 A G 2: 92,196,825 (GRCm39) L477P probably damaging Het
Lnpep T C 17: 17,799,245 (GRCm39) T137A possibly damaging Het
Mettl3 T C 14: 52,534,215 (GRCm39) probably null Het
Mical3 C T 6: 120,935,684 (GRCm39) S1614N probably damaging Het
Mmut T A 17: 41,249,622 (GRCm39) V199E possibly damaging Het
Morc3 C A 16: 93,642,082 (GRCm39) Y100* probably null Het
Mrc2 A G 11: 105,237,646 (GRCm39) K1108R probably benign Het
Mrpl2 T C 17: 46,960,835 (GRCm39) V243A probably damaging Het
Mtor T A 4: 148,605,794 (GRCm39) N1505K probably benign Het
Myo1g A T 11: 6,469,168 (GRCm39) Y45N probably damaging Het
Nckap5l C A 15: 99,325,905 (GRCm39) L199F possibly damaging Het
Ndufc2 A G 7: 97,056,099 (GRCm39) T66A probably damaging Het
Nos1 T A 5: 118,050,917 (GRCm39) H779Q probably damaging Het
Or12e13 A G 2: 87,663,661 (GRCm39) T93A probably benign Het
Or13j1 T C 4: 43,705,698 (GRCm39) Y290C probably damaging Het
Or1e23 T C 11: 73,407,831 (GRCm39) N65D probably damaging Het
Or4c3 A G 2: 89,851,573 (GRCm39) probably null Het
Or51ah3 A T 7: 103,210,489 (GRCm39) R268S probably benign Het
Or5au1 C A 14: 52,272,825 (GRCm39) V248L possibly damaging Het
Or5k16 T C 16: 58,736,545 (GRCm39) N153S probably benign Het
Otog C T 7: 45,898,458 (GRCm39) T192I possibly damaging Het
Oxct1 T C 15: 4,064,812 (GRCm39) V50A probably benign Het
P3h2 T A 16: 25,784,493 (GRCm39) D667V probably damaging Het
Pcdhb20 A G 18: 37,638,047 (GRCm39) Y191C probably damaging Het
Pds5b T G 5: 150,670,083 (GRCm39) V357G probably damaging Het
Pggt1b A G 18: 46,407,674 (GRCm39) V81A possibly damaging Het
Phxr2 A G 10: 98,962,043 (GRCm39) probably benign Het
Pnpt1 T C 11: 29,095,469 (GRCm39) I406T probably benign Het
Ppat T C 5: 77,070,202 (GRCm39) I173V probably damaging Het
Proser3 T C 7: 30,243,153 (GRCm39) S167G probably damaging Het
Rnf135 A C 11: 80,080,053 (GRCm39) T115P possibly damaging Het
Rpl22 C T 4: 152,414,536 (GRCm39) R65C probably benign Het
Scel T C 14: 103,829,420 (GRCm39) F405L probably benign Het
Serinc3 A G 2: 163,469,799 (GRCm39) Y350H probably damaging Het
Slc25a16 C A 10: 62,764,102 (GRCm39) T53K probably damaging Het
Slco1a1 A T 6: 141,870,215 (GRCm39) F308I possibly damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,917,248 (GRCm39) probably benign Het
Smok3c T C 5: 138,063,314 (GRCm39) V267A probably benign Het
Ssrp1 A G 2: 84,873,158 (GRCm39) D473G probably benign Het
Svs6 A G 2: 164,159,405 (GRCm39) E56G possibly damaging Het
Tas2r130 TCATTTC T 6: 131,607,547 (GRCm39) probably benign Het
Thoc3 T C 13: 54,615,785 (GRCm39) N93S probably benign Het
Tle6 A G 10: 81,428,600 (GRCm39) C443R probably damaging Het
Tmed6 A G 8: 107,788,371 (GRCm39) F192S probably damaging Het
Tpx2 A G 2: 152,718,548 (GRCm39) N184D probably benign Het
Vmn2r31 T A 7: 7,397,638 (GRCm39) N207Y probably benign Het
Zfp267 T C 3: 36,220,352 (GRCm39) F792L probably benign Het
Zfp709 TCGACG TCG 8: 72,644,552 (GRCm39) probably benign Het
Zfp972 A T 2: 177,549,117 (GRCm39) probably null Het
Zzef1 G A 11: 72,760,631 (GRCm39) C1318Y possibly damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34,953,402 (GRCm39) missense probably damaging 1.00
IGL00433:C4b APN 17 34,961,015 (GRCm39) missense possibly damaging 0.75
IGL00471:C4b APN 17 34,953,403 (GRCm39) missense probably damaging 1.00
IGL00515:C4b APN 17 34,947,865 (GRCm39) missense probably damaging 1.00
IGL01599:C4b APN 17 34,961,993 (GRCm39) splice site probably benign
IGL01761:C4b APN 17 34,958,912 (GRCm39) missense possibly damaging 0.56
IGL02004:C4b APN 17 34,957,984 (GRCm39) unclassified probably benign
IGL02215:C4b APN 17 34,953,465 (GRCm39) missense probably damaging 1.00
IGL02517:C4b APN 17 34,953,382 (GRCm39) missense probably benign 0.01
IGL02926:C4b APN 17 34,949,686 (GRCm39) missense possibly damaging 0.95
IGL03031:C4b APN 17 34,950,104 (GRCm39) missense possibly damaging 0.47
IGL03057:C4b APN 17 34,956,738 (GRCm39) unclassified probably benign
IGL03165:C4b APN 17 34,958,929 (GRCm39) missense probably benign 0.13
IGL03380:C4b APN 17 34,959,260 (GRCm39) missense probably benign 0.01
Aspiration UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
Inspiration UTSW 17 34,951,140 (GRCm39) splice site probably null
Peroration UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
perspiration UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
FR4548:C4b UTSW 17 34,959,971 (GRCm39) missense probably benign 0.00
PIT4142001:C4b UTSW 17 34,952,675 (GRCm39) missense probably benign 0.01
R0064:C4b UTSW 17 34,957,830 (GRCm39) missense probably damaging 1.00
R0113:C4b UTSW 17 34,960,214 (GRCm39) missense probably damaging 0.98
R0143:C4b UTSW 17 34,953,193 (GRCm39) unclassified probably benign
R0254:C4b UTSW 17 34,953,750 (GRCm39) missense probably benign 0.00
R0320:C4b UTSW 17 34,952,135 (GRCm39) missense probably benign 0.01
R0391:C4b UTSW 17 34,954,588 (GRCm39) splice site probably benign
R0399:C4b UTSW 17 34,947,843 (GRCm39) missense probably damaging 1.00
R0467:C4b UTSW 17 34,955,101 (GRCm39) missense probably benign 0.01
R0549:C4b UTSW 17 34,954,389 (GRCm39) missense probably damaging 1.00
R0561:C4b UTSW 17 34,953,391 (GRCm39) missense probably damaging 0.99
R0662:C4b UTSW 17 34,949,862 (GRCm39) missense probably damaging 1.00
R0941:C4b UTSW 17 34,959,029 (GRCm39) missense probably benign
R1161:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1169:C4b UTSW 17 34,961,946 (GRCm39) missense probably benign 0.14
R1186:C4b UTSW 17 34,955,283 (GRCm39) missense possibly damaging 0.47
R1310:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1398:C4b UTSW 17 34,949,693 (GRCm39) unclassified probably benign
R1472:C4b UTSW 17 34,962,743 (GRCm39) nonsense probably null
R1496:C4b UTSW 17 34,958,995 (GRCm39) missense probably benign 0.30
R1544:C4b UTSW 17 34,957,941 (GRCm39) missense probably benign 0.13
R1588:C4b UTSW 17 34,959,999 (GRCm39) missense probably benign
R1645:C4b UTSW 17 34,959,571 (GRCm39) missense probably damaging 1.00
R1664:C4b UTSW 17 34,951,952 (GRCm39) missense probably damaging 1.00
R1678:C4b UTSW 17 34,962,624 (GRCm39) missense probably benign 0.05
R1710:C4b UTSW 17 34,962,638 (GRCm39) splice site probably benign
R1713:C4b UTSW 17 34,948,245 (GRCm39) splice site probably benign
R1770:C4b UTSW 17 34,955,901 (GRCm39) missense possibly damaging 0.78
R1859:C4b UTSW 17 34,954,527 (GRCm39) missense probably benign
R1924:C4b UTSW 17 34,948,631 (GRCm39) missense probably damaging 1.00
R2057:C4b UTSW 17 34,947,594 (GRCm39) missense probably damaging 1.00
R2060:C4b UTSW 17 34,955,075 (GRCm39) missense probably damaging 1.00
R2184:C4b UTSW 17 34,956,676 (GRCm39) missense probably benign 0.27
R2306:C4b UTSW 17 34,947,492 (GRCm39) missense probably benign 0.00
R2363:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2365:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2379:C4b UTSW 17 34,954,717 (GRCm39) missense possibly damaging 0.81
R2860:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R2861:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R3551:C4b UTSW 17 34,960,846 (GRCm39) missense possibly damaging 0.75
R3765:C4b UTSW 17 34,948,814 (GRCm39) missense probably damaging 0.98
R4157:C4b UTSW 17 34,961,829 (GRCm39) missense probably damaging 1.00
R4299:C4b UTSW 17 34,950,118 (GRCm39) missense possibly damaging 0.52
R4365:C4b UTSW 17 34,953,717 (GRCm39) missense possibly damaging 0.65
R4411:C4b UTSW 17 34,947,838 (GRCm39) missense probably damaging 1.00
R4613:C4b UTSW 17 34,953,525 (GRCm39) missense probably benign 0.12
R4784:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R4790:C4b UTSW 17 34,953,117 (GRCm39) missense probably benign 0.01
R4831:C4b UTSW 17 34,955,864 (GRCm39) splice site probably null
R4879:C4b UTSW 17 34,962,621 (GRCm39) missense probably damaging 0.99
R5036:C4b UTSW 17 34,959,419 (GRCm39) critical splice acceptor site probably null
R5361:C4b UTSW 17 34,960,212 (GRCm39) missense probably benign 0.15
R5384:C4b UTSW 17 34,956,635 (GRCm39) missense possibly damaging 0.89
R5518:C4b UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
R5590:C4b UTSW 17 34,959,309 (GRCm39) missense probably damaging 0.98
R5643:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5644:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5833:C4b UTSW 17 34,949,647 (GRCm39) missense probably damaging 1.00
R5931:C4b UTSW 17 34,948,167 (GRCm39) missense probably damaging 0.99
R6178:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R6209:C4b UTSW 17 34,960,061 (GRCm39) missense possibly damaging 0.93
R6518:C4b UTSW 17 34,953,179 (GRCm39) missense probably damaging 0.98
R6613:C4b UTSW 17 34,952,539 (GRCm39) missense probably damaging 0.99
R6781:C4b UTSW 17 34,961,928 (GRCm39) missense probably damaging 0.99
R6807:C4b UTSW 17 34,949,930 (GRCm39) missense probably benign 0.17
R6858:C4b UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
R6962:C4b UTSW 17 34,951,140 (GRCm39) splice site probably null
R7068:C4b UTSW 17 34,952,451 (GRCm39) missense probably damaging 1.00
R7081:C4b UTSW 17 34,954,417 (GRCm39) missense probably benign 0.27
R7105:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R7211:C4b UTSW 17 34,954,508 (GRCm39) missense possibly damaging 0.92
R7296:C4b UTSW 17 34,962,633 (GRCm39) missense probably damaging 1.00
R7314:C4b UTSW 17 34,959,330 (GRCm39) missense probably benign
R7330:C4b UTSW 17 34,949,446 (GRCm39) missense probably damaging 1.00
R7397:C4b UTSW 17 34,961,364 (GRCm39) missense possibly damaging 0.80
R7437:C4b UTSW 17 34,953,707 (GRCm39) missense probably benign 0.10
R7490:C4b UTSW 17 34,950,054 (GRCm39) nonsense probably null
R7597:C4b UTSW 17 34,958,649 (GRCm39) missense probably benign
R7633:C4b UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
R7900:C4b UTSW 17 34,958,751 (GRCm39) missense probably benign 0.03
R7910:C4b UTSW 17 34,959,326 (GRCm39) missense probably benign 0.00
R7923:C4b UTSW 17 34,961,354 (GRCm39) missense probably damaging 1.00
R7960:C4b UTSW 17 34,960,252 (GRCm39) splice site probably null
R8420:C4b UTSW 17 34,953,513 (GRCm39) missense probably damaging 0.97
R8467:C4b UTSW 17 34,951,787 (GRCm39) missense possibly damaging 0.51
R8558:C4b UTSW 17 34,955,541 (GRCm39) missense probably damaging 1.00
R8725:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8727:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8853:C4b UTSW 17 34,948,879 (GRCm39) missense possibly damaging 0.91
R8934:C4b UTSW 17 34,951,958 (GRCm39) missense possibly damaging 0.78
R8944:C4b UTSW 17 34,961,913 (GRCm39) missense probably benign 0.00
R8960:C4b UTSW 17 34,952,892 (GRCm39) missense probably damaging 1.00
R8982:C4b UTSW 17 34,953,338 (GRCm39) critical splice donor site probably null
R9104:C4b UTSW 17 34,948,233 (GRCm39) missense probably benign 0.39
R9114:C4b UTSW 17 34,948,404 (GRCm39) missense probably damaging 0.99
R9348:C4b UTSW 17 34,952,159 (GRCm39) missense probably benign 0.01
R9428:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R9533:C4b UTSW 17 34,956,698 (GRCm39) nonsense probably null
R9591:C4b UTSW 17 34,957,929 (GRCm39) missense probably benign 0.00
R9678:C4b UTSW 17 34,960,763 (GRCm39) critical splice donor site probably null
Z1176:C4b UTSW 17 34,950,121 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGAGGAGGATGAAGAGGAC -3'
(R):5'- CCCCACCTGGATTCTGGGG -3'

Sequencing Primer
(F):5'- CAAGGCAGAGGCACAGG -3'
(R):5'- TCAGTCCTCATGCATGGATGGC -3'
Posted On 2018-02-28