Incidental Mutation 'R6226:Olfr1115'
ID504315
Institutional Source Beutler Lab
Gene Symbol Olfr1115
Ensembl Gene ENSMUSG00000070856
Gene Nameolfactory receptor 1115
SynonymsMOR264-20, MOR273-4P, MOR273-4P, Olfr1530-ps1, GA_x6K02T2Q125-48736906-48737886
MMRRC Submission 044397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6226 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87248013-87253868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87252392 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 152 (S152G)
Ref Sequence ENSEMBL: ENSMUSP00000150996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081986] [ENSMUST00000213513] [ENSMUST00000214119] [ENSMUST00000217196]
Predicted Effect probably benign
Transcript: ENSMUST00000081986
AA Change: S152G

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080647
Gene: ENSMUSG00000070856
AA Change: S152G

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 5e-54 PFAM
Pfam:7tm_1 56 305 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183480
Predicted Effect probably benign
Transcript: ENSMUST00000213513
AA Change: S152G

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000214119
AA Change: S152G

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217196
AA Change: S152G

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,278,967 T62A probably benign Het
Adam33 G A 2: 131,055,610 T265I probably damaging Het
Afap1l2 T C 19: 56,916,128 T654A probably benign Het
Agrn A G 4: 156,173,609 S992P probably damaging Het
Anapc1 A G 2: 128,650,372 F939L probably damaging Het
Anks1 G A 17: 28,057,330 V1016I probably benign Het
Ankzf1 A G 1: 75,196,594 T401A probably benign Het
Atad1 G T 19: 32,701,587 D105E probably benign Het
AU019823 T C 9: 50,607,770 T181A possibly damaging Het
Carmil2 A G 8: 105,689,032 T313A possibly damaging Het
Cdk15 T C 1: 59,265,633 V131A probably damaging Het
Cldnd1 A T 16: 58,731,300 probably null Het
Col16a1 A T 4: 130,055,089 probably benign Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Dnah7b A C 1: 46,126,668 K498Q probably benign Het
Dnase2b A G 3: 146,584,563 Y218H probably benign Het
Dsg2 T A 18: 20,579,449 V170D probably damaging Het
Dst T C 1: 34,270,874 V1543A probably damaging Het
Ell3 A T 2: 121,441,777 I72K probably damaging Het
Fank1 A G 7: 133,862,198 Y41C probably benign Het
Foxd3 T C 4: 99,657,024 Y134H probably damaging Het
Frmd6 A G 12: 70,863,911 probably benign Het
Gale A G 4: 135,965,605 E53G possibly damaging Het
Glis3 A G 19: 28,317,302 S699P probably damaging Het
Gm12830 T A 4: 114,845,049 M136K unknown Het
Grik3 T C 4: 125,659,789 V438A probably benign Het
Gsap A G 5: 21,217,431 N133D probably damaging Het
Gsg1 T A 6: 135,240,112 D239V probably damaging Het
H2-T10 A T 17: 36,121,083 W23R probably damaging Het
Itgae A G 11: 73,140,757 T1100A probably benign Het
Kcnh7 A T 2: 62,777,559 F559L probably damaging Het
Kdm5b G T 1: 134,608,878 R612L probably damaging Het
Lrrc74a T A 12: 86,748,457 N253K possibly damaging Het
Mcm3ap A G 10: 76,515,706 H1961R possibly damaging Het
Ncam1 C T 9: 49,565,004 E262K probably benign Het
Nckap1 A G 2: 80,508,781 S968P possibly damaging Het
Nr2f2 T G 7: 70,359,996 S112R probably benign Het
Nup93 T C 8: 94,286,537 W137R probably damaging Het
Olfr1251 A T 2: 89,666,989 L299H probably damaging Het
Olfr1395 A G 11: 49,148,833 D192G possibly damaging Het
Olfr664 A T 7: 104,734,036 F109L probably damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Olfr922 T C 9: 38,816,370 I289T probably damaging Het
Otogl A T 10: 107,771,206 Y2105* probably null Het
Pibf1 A G 14: 99,101,119 S24G probably damaging Het
Pitx2 C T 3: 129,215,842 R130W probably damaging Het
Pkd1l1 T C 11: 8,901,287 N715S probably benign Het
Pou6f2 A T 13: 18,129,154 I123N possibly damaging Het
Prss29 T A 17: 25,320,539 H35Q possibly damaging Het
Ptpn21 A G 12: 98,680,116 F1028L probably benign Het
Ptpn21 A T 12: 98,715,172 Y68N probably damaging Het
Ptprk A G 10: 28,564,103 T856A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl22l1 A G 3: 28,806,527 T13A possibly damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sec14l5 G A 16: 5,176,565 V408I probably damaging Het
Serpina5 T C 12: 104,101,778 S33P possibly damaging Het
Sgip1 A G 4: 102,966,195 N524S probably damaging Het
Shkbp1 C A 7: 27,351,980 R218M probably null Het
Sorcs1 T A 19: 50,181,414 I970F probably damaging Het
Spg11 A G 2: 122,088,262 V962A possibly damaging Het
Sptbn1 A G 11: 30,136,054 M1205T probably damaging Het
Sufu G A 19: 46,473,654 V369M probably damaging Het
Tmem98 T C 11: 80,821,394 F219S probably benign Het
Trim27 T C 13: 21,180,916 probably benign Het
Trim43b T C 9: 89,091,275 E135G possibly damaging Het
Ube2m A G 7: 13,035,888 V110A probably damaging Het
Ugt2b36 A G 5: 87,092,130 V132A probably damaging Het
Usp36 A T 11: 118,277,274 S86T probably damaging Het
Zfp941 A T 7: 140,812,485 D320E probably benign Het
Other mutations in Olfr1115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Olfr1115 APN 2 87252462 missense probably damaging 1.00
IGL01376:Olfr1115 APN 2 87252873 missense possibly damaging 0.58
IGL02167:Olfr1115 APN 2 87252198 missense probably benign 0.18
IGL02224:Olfr1115 APN 2 87252477 missense probably benign 0.42
IGL02388:Olfr1115 APN 2 87251951 missense probably benign
IGL02596:Olfr1115 APN 2 87252129 missense probably damaging 0.98
PIT4131001:Olfr1115 UTSW 2 87252629 missense probably benign 0.01
R0140:Olfr1115 UTSW 2 87252625 missense probably damaging 1.00
R0468:Olfr1115 UTSW 2 87252255 missense probably benign 0.04
R1222:Olfr1115 UTSW 2 87252422 missense probably benign 0.04
R1418:Olfr1115 UTSW 2 87252422 missense probably benign 0.04
R1742:Olfr1115 UTSW 2 87252778 missense probably benign 0.01
R1822:Olfr1115 UTSW 2 87252710 missense possibly damaging 0.91
R2332:Olfr1115 UTSW 2 87252873 missense possibly damaging 0.58
R3123:Olfr1115 UTSW 2 87252791 missense possibly damaging 0.67
R3407:Olfr1115 UTSW 2 87252899 missense probably benign 0.00
R4571:Olfr1115 UTSW 2 87252458 missense possibly damaging 0.67
R4710:Olfr1115 UTSW 2 87252040 missense possibly damaging 0.64
R4889:Olfr1115 UTSW 2 87252647 missense probably damaging 0.97
R5031:Olfr1115 UTSW 2 87252082 missense probably benign
R5288:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5385:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5386:Olfr1115 UTSW 2 87252483 missense probably benign 0.06
R5669:Olfr1115 UTSW 2 87252441 missense probably benign 0.00
R6187:Olfr1115 UTSW 2 87252698 missense probably damaging 1.00
R6598:Olfr1115 UTSW 2 87252756 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACAAGAGTTGAACCCACTCTG -3'
(R):5'- GATGTTCCCACATGCCAATC -3'

Sequencing Primer
(F):5'- GTCACTCTTCCTAGAATGCTTATGG -3'
(R):5'- CCACATGCCAATCTGAGTAGTGG -3'
Posted On2018-02-28