Incidental Mutation 'R6226:Pitx2'
ID504323
Institutional Source Beutler Lab
Gene Symbol Pitx2
Ensembl Gene ENSMUSG00000028023
Gene Namepaired-like homeodomain transcription factor 2
SynonymsPitx2b, Pitx2a, Brx1, solurshin, Brx1a, Brx1b, Ptx2, Otlx2, Pitx2c, Rieg, Munc30
MMRRC Submission 044397-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6226 (G1)
Quality Score164.009
Status Not validated
Chromosome3
Chromosomal Location129199878-129219591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129215842 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 130 (R130W)
Ref Sequence ENSEMBL: ENSMUSP00000133756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029657] [ENSMUST00000042587] [ENSMUST00000106382] [ENSMUST00000172645] [ENSMUST00000174623] [ENSMUST00000174661]
Predicted Effect probably benign
Transcript: ENSMUST00000029657
Predicted Effect probably damaging
Transcript: ENSMUST00000042587
AA Change: R137W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047359
Gene: ENSMUSG00000028023
AA Change: R137W

DomainStartEndE-ValueType
HOX 92 154 6.5e-26 SMART
low complexity region 213 236 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
Pfam:OAR 282 300 4.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106382
AA Change: R84W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101990
Gene: ENSMUSG00000028023
AA Change: R84W

DomainStartEndE-ValueType
HOX 39 101 6.5e-26 SMART
low complexity region 160 183 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
Pfam:OAR 228 248 2.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172645
AA Change: R117W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134692
Gene: ENSMUSG00000028023
AA Change: R117W

DomainStartEndE-ValueType
HOX 72 134 6.5e-26 SMART
low complexity region 193 216 N/A INTRINSIC
low complexity region 224 242 N/A INTRINSIC
low complexity region 243 260 N/A INTRINSIC
Pfam:OAR 262 280 9.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174623
AA Change: R137W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139328
Gene: ENSMUSG00000028023
AA Change: R137W

DomainStartEndE-ValueType
HOX 92 151 1.37e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174661
AA Change: R130W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133756
Gene: ENSMUSG00000028023
AA Change: R130W

DomainStartEndE-ValueType
HOX 85 147 6.5e-26 SMART
low complexity region 206 229 N/A INTRINSIC
low complexity region 237 255 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
Pfam:OAR 274 294 1.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187145
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. The encoded protein acts as a transcription factor and regulates procollagen lysyl hydroxylase gene expression. This protein plays a role in the terminal differentiation of somatotroph and lactotroph cell phenotypes, is involved in the development of the eye, tooth and abdominal organs, and acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. Mutations in this gene are associated with Axenfeld-Rieger syndrome, iridogoniodysgenesis syndrome, and sporadic cases of Peters anomaly. A similar protein in other vertebrates is involved in the determination of left-right asymmetry during development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations show failed ventral body wall closure, right pulmonary isomerism, septal and valve defects, absent ocular muscles, arrested pituitary and tooth development, optic nerve, mandible and maxilla defects, and embryonic death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,278,967 T62A probably benign Het
Adam33 G A 2: 131,055,610 T265I probably damaging Het
Afap1l2 T C 19: 56,916,128 T654A probably benign Het
Agrn A G 4: 156,173,609 S992P probably damaging Het
Anapc1 A G 2: 128,650,372 F939L probably damaging Het
Anks1 G A 17: 28,057,330 V1016I probably benign Het
Ankzf1 A G 1: 75,196,594 T401A probably benign Het
Atad1 G T 19: 32,701,587 D105E probably benign Het
AU019823 T C 9: 50,607,770 T181A possibly damaging Het
Carmil2 A G 8: 105,689,032 T313A possibly damaging Het
Cdk15 T C 1: 59,265,633 V131A probably damaging Het
Cldnd1 A T 16: 58,731,300 probably null Het
Col16a1 A T 4: 130,055,089 probably benign Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Dnah7b A C 1: 46,126,668 K498Q probably benign Het
Dnase2b A G 3: 146,584,563 Y218H probably benign Het
Dsg2 T A 18: 20,579,449 V170D probably damaging Het
Dst T C 1: 34,270,874 V1543A probably damaging Het
Ell3 A T 2: 121,441,777 I72K probably damaging Het
Fank1 A G 7: 133,862,198 Y41C probably benign Het
Foxd3 T C 4: 99,657,024 Y134H probably damaging Het
Frmd6 A G 12: 70,863,911 probably benign Het
Gale A G 4: 135,965,605 E53G possibly damaging Het
Glis3 A G 19: 28,317,302 S699P probably damaging Het
Gm12830 T A 4: 114,845,049 M136K unknown Het
Grik3 T C 4: 125,659,789 V438A probably benign Het
Gsap A G 5: 21,217,431 N133D probably damaging Het
Gsg1 T A 6: 135,240,112 D239V probably damaging Het
H2-T10 A T 17: 36,121,083 W23R probably damaging Het
Itgae A G 11: 73,140,757 T1100A probably benign Het
Kcnh7 A T 2: 62,777,559 F559L probably damaging Het
Kdm5b G T 1: 134,608,878 R612L probably damaging Het
Lrrc74a T A 12: 86,748,457 N253K possibly damaging Het
Mcm3ap A G 10: 76,515,706 H1961R possibly damaging Het
Ncam1 C T 9: 49,565,004 E262K probably benign Het
Nckap1 A G 2: 80,508,781 S968P possibly damaging Het
Nr2f2 T G 7: 70,359,996 S112R probably benign Het
Nup93 T C 8: 94,286,537 W137R probably damaging Het
Olfr1115 A G 2: 87,252,392 S152G probably benign Het
Olfr1251 A T 2: 89,666,989 L299H probably damaging Het
Olfr1395 A G 11: 49,148,833 D192G possibly damaging Het
Olfr664 A T 7: 104,734,036 F109L probably damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Olfr922 T C 9: 38,816,370 I289T probably damaging Het
Otogl A T 10: 107,771,206 Y2105* probably null Het
Pibf1 A G 14: 99,101,119 S24G probably damaging Het
Pkd1l1 T C 11: 8,901,287 N715S probably benign Het
Pou6f2 A T 13: 18,129,154 I123N possibly damaging Het
Prss29 T A 17: 25,320,539 H35Q possibly damaging Het
Ptpn21 A G 12: 98,680,116 F1028L probably benign Het
Ptpn21 A T 12: 98,715,172 Y68N probably damaging Het
Ptprk A G 10: 28,564,103 T856A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl22l1 A G 3: 28,806,527 T13A possibly damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sec14l5 G A 16: 5,176,565 V408I probably damaging Het
Serpina5 T C 12: 104,101,778 S33P possibly damaging Het
Sgip1 A G 4: 102,966,195 N524S probably damaging Het
Shkbp1 C A 7: 27,351,980 R218M probably null Het
Sorcs1 T A 19: 50,181,414 I970F probably damaging Het
Spg11 A G 2: 122,088,262 V962A possibly damaging Het
Sptbn1 A G 11: 30,136,054 M1205T probably damaging Het
Sufu G A 19: 46,473,654 V369M probably damaging Het
Tmem98 T C 11: 80,821,394 F219S probably benign Het
Trim27 T C 13: 21,180,916 probably benign Het
Trim43b T C 9: 89,091,275 E135G possibly damaging Het
Ube2m A G 7: 13,035,888 V110A probably damaging Het
Ugt2b36 A G 5: 87,092,130 V132A probably damaging Het
Usp36 A T 11: 118,277,274 S86T probably damaging Het
Zfp941 A T 7: 140,812,485 D320E probably benign Het
Other mutations in Pitx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Pitx2 APN 3 129214764 missense probably damaging 0.99
IGL02110:Pitx2 APN 3 129218817 missense probably damaging 0.99
R0014:Pitx2 UTSW 3 129218499 missense possibly damaging 0.70
R1083:Pitx2 UTSW 3 129218769 missense probably damaging 1.00
R1474:Pitx2 UTSW 3 129218839 missense probably damaging 1.00
R1789:Pitx2 UTSW 3 129218754 missense probably damaging 1.00
R1945:Pitx2 UTSW 3 129218536 missense probably damaging 1.00
R5305:Pitx2 UTSW 3 129215840 missense probably damaging 1.00
R5950:Pitx2 UTSW 3 129218520 missense probably damaging 1.00
R6114:Pitx2 UTSW 3 129204413 intron probably null
R6189:Pitx2 UTSW 3 129218469 missense probably damaging 1.00
R6192:Pitx2 UTSW 3 129215872 missense probably benign 0.09
R6526:Pitx2 UTSW 3 129214783 critical splice donor site probably null
R6778:Pitx2 UTSW 3 129218743 missense probably damaging 1.00
R6885:Pitx2 UTSW 3 129218608 missense probably damaging 1.00
R7575:Pitx2 UTSW 3 129215726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGTCTGACCCGAAACTATG -3'
(R):5'- CACAATGCCCTTTGCTGAGG -3'

Sequencing Primer
(F):5'- TGCTTTTTCAGAGAAAGATAAGGGCC -3'
(R):5'- AATGCCCTTTGCTGAGGAATGC -3'
Posted On2018-02-28