Incidental Mutation 'R6226:Gsg1'
ID504334
Institutional Source Beutler Lab
Gene Symbol Gsg1
Ensembl Gene ENSMUSG00000030206
Gene Namegerm cell associated 1
Synonyms
MMRRC Submission 044397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6226 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location135237326-135254351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135240112 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 239 (D239V)
Ref Sequence ENSEMBL: ENSMUSP00000107542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087729] [ENSMUST00000111909] [ENSMUST00000111910] [ENSMUST00000111911] [ENSMUST00000111915] [ENSMUST00000111916]
Predicted Effect probably damaging
Transcript: ENSMUST00000087729
AA Change: D242V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085022
Gene: ENSMUSG00000030206
AA Change: D242V

DomainStartEndE-ValueType
Pfam:GSG-1 11 125 2e-44 PFAM
Pfam:PMP22_Claudin 169 270 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111909
AA Change: D198V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107540
Gene: ENSMUSG00000030206
AA Change: D198V

DomainStartEndE-ValueType
Pfam:GSG-1 5 123 3.1e-44 PFAM
Pfam:PMP22_Claudin 12 226 4.5e-11 PFAM
Pfam:Claudin_2 20 226 8.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111910
AA Change: D239V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107541
Gene: ENSMUSG00000030206
AA Change: D239V

DomainStartEndE-ValueType
Pfam:GSG-1 5 123 5.2e-44 PFAM
Pfam:Claudin_2 20 267 1.5e-9 PFAM
Pfam:PMP22_Claudin 166 267 8.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111911
AA Change: D239V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107542
Gene: ENSMUSG00000030206
AA Change: D239V

DomainStartEndE-ValueType
Pfam:GSG-1 5 123 5.2e-44 PFAM
Pfam:Claudin_2 20 267 1.5e-9 PFAM
Pfam:PMP22_Claudin 166 267 8.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111915
SMART Domains Protein: ENSMUSP00000107546
Gene: ENSMUSG00000030207

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111916
SMART Domains Protein: ENSMUSP00000107547
Gene: ENSMUSG00000030207

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151951
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,278,967 T62A probably benign Het
Adam33 G A 2: 131,055,610 T265I probably damaging Het
Afap1l2 T C 19: 56,916,128 T654A probably benign Het
Agrn A G 4: 156,173,609 S992P probably damaging Het
Anapc1 A G 2: 128,650,372 F939L probably damaging Het
Anks1 G A 17: 28,057,330 V1016I probably benign Het
Ankzf1 A G 1: 75,196,594 T401A probably benign Het
Atad1 G T 19: 32,701,587 D105E probably benign Het
AU019823 T C 9: 50,607,770 T181A possibly damaging Het
Carmil2 A G 8: 105,689,032 T313A possibly damaging Het
Cdk15 T C 1: 59,265,633 V131A probably damaging Het
Cldnd1 A T 16: 58,731,300 probably null Het
Col16a1 A T 4: 130,055,089 probably benign Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Dnah7b A C 1: 46,126,668 K498Q probably benign Het
Dnase2b A G 3: 146,584,563 Y218H probably benign Het
Dsg2 T A 18: 20,579,449 V170D probably damaging Het
Dst T C 1: 34,270,874 V1543A probably damaging Het
Ell3 A T 2: 121,441,777 I72K probably damaging Het
Fank1 A G 7: 133,862,198 Y41C probably benign Het
Foxd3 T C 4: 99,657,024 Y134H probably damaging Het
Frmd6 A G 12: 70,863,911 probably benign Het
Gale A G 4: 135,965,605 E53G possibly damaging Het
Glis3 A G 19: 28,317,302 S699P probably damaging Het
Gm12830 T A 4: 114,845,049 M136K unknown Het
Grik3 T C 4: 125,659,789 V438A probably benign Het
Gsap A G 5: 21,217,431 N133D probably damaging Het
H2-T10 A T 17: 36,121,083 W23R probably damaging Het
Itgae A G 11: 73,140,757 T1100A probably benign Het
Kcnh7 A T 2: 62,777,559 F559L probably damaging Het
Kdm5b G T 1: 134,608,878 R612L probably damaging Het
Lrrc74a T A 12: 86,748,457 N253K possibly damaging Het
Mcm3ap A G 10: 76,515,706 H1961R possibly damaging Het
Ncam1 C T 9: 49,565,004 E262K probably benign Het
Nckap1 A G 2: 80,508,781 S968P possibly damaging Het
Nr2f2 T G 7: 70,359,996 S112R probably benign Het
Nup93 T C 8: 94,286,537 W137R probably damaging Het
Olfr1115 A G 2: 87,252,392 S152G probably benign Het
Olfr1251 A T 2: 89,666,989 L299H probably damaging Het
Olfr1395 A G 11: 49,148,833 D192G possibly damaging Het
Olfr664 A T 7: 104,734,036 F109L probably damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Olfr922 T C 9: 38,816,370 I289T probably damaging Het
Otogl A T 10: 107,771,206 Y2105* probably null Het
Pibf1 A G 14: 99,101,119 S24G probably damaging Het
Pitx2 C T 3: 129,215,842 R130W probably damaging Het
Pkd1l1 T C 11: 8,901,287 N715S probably benign Het
Pou6f2 A T 13: 18,129,154 I123N possibly damaging Het
Prss29 T A 17: 25,320,539 H35Q possibly damaging Het
Ptpn21 A G 12: 98,680,116 F1028L probably benign Het
Ptpn21 A T 12: 98,715,172 Y68N probably damaging Het
Ptprk A G 10: 28,564,103 T856A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl22l1 A G 3: 28,806,527 T13A possibly damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sec14l5 G A 16: 5,176,565 V408I probably damaging Het
Serpina5 T C 12: 104,101,778 S33P possibly damaging Het
Sgip1 A G 4: 102,966,195 N524S probably damaging Het
Shkbp1 C A 7: 27,351,980 R218M probably null Het
Sorcs1 T A 19: 50,181,414 I970F probably damaging Het
Spg11 A G 2: 122,088,262 V962A possibly damaging Het
Sptbn1 A G 11: 30,136,054 M1205T probably damaging Het
Sufu G A 19: 46,473,654 V369M probably damaging Het
Tmem98 T C 11: 80,821,394 F219S probably benign Het
Trim27 T C 13: 21,180,916 probably benign Het
Trim43b T C 9: 89,091,275 E135G possibly damaging Het
Ube2m A G 7: 13,035,888 V110A probably damaging Het
Ugt2b36 A G 5: 87,092,130 V132A probably damaging Het
Usp36 A T 11: 118,277,274 S86T probably damaging Het
Zfp941 A T 7: 140,812,485 D320E probably benign Het
Other mutations in Gsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Gsg1 APN 6 135244350 missense possibly damaging 0.95
IGL00835:Gsg1 APN 6 135244092 missense possibly damaging 0.48
PIT4514001:Gsg1 UTSW 6 135237576 missense probably benign
PIT4585001:Gsg1 UTSW 6 135237560 missense probably benign
R2180:Gsg1 UTSW 6 135240145 missense probably damaging 1.00
R3522:Gsg1 UTSW 6 135241253 missense probably damaging 1.00
R4735:Gsg1 UTSW 6 135237407 missense possibly damaging 0.95
R5183:Gsg1 UTSW 6 135241370 missense probably damaging 1.00
R5778:Gsg1 UTSW 6 135244350 missense possibly damaging 0.95
R6739:Gsg1 UTSW 6 135237614 missense probably damaging 1.00
R6890:Gsg1 UTSW 6 135237420 missense probably benign 0.00
R7486:Gsg1 UTSW 6 135237429 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGTTGCATCCTCAAAGCCAGAG -3'
(R):5'- AGATGCTCCTCCCACAGTATC -3'

Sequencing Primer
(F):5'- GAGGAGAATGTTCTATGCACCCTC -3'
(R):5'- CCACAGTATCCCAGGAAATGTGATG -3'
Posted On2018-02-28