Incidental Mutation 'R6226:Otogl'
ID504350
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission 044397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6226 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 107771206 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 2105 (Y2105*)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect probably null
Transcript: ENSMUST00000165341
AA Change: Y2105*
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: Y2105*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,278,967 T62A probably benign Het
Adam33 G A 2: 131,055,610 T265I probably damaging Het
Afap1l2 T C 19: 56,916,128 T654A probably benign Het
Agrn A G 4: 156,173,609 S992P probably damaging Het
Anapc1 A G 2: 128,650,372 F939L probably damaging Het
Anks1 G A 17: 28,057,330 V1016I probably benign Het
Ankzf1 A G 1: 75,196,594 T401A probably benign Het
Atad1 G T 19: 32,701,587 D105E probably benign Het
AU019823 T C 9: 50,607,770 T181A possibly damaging Het
Carmil2 A G 8: 105,689,032 T313A possibly damaging Het
Cdk15 T C 1: 59,265,633 V131A probably damaging Het
Cldnd1 A T 16: 58,731,300 probably null Het
Col16a1 A T 4: 130,055,089 probably benign Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Dnah7b A C 1: 46,126,668 K498Q probably benign Het
Dnase2b A G 3: 146,584,563 Y218H probably benign Het
Dsg2 T A 18: 20,579,449 V170D probably damaging Het
Dst T C 1: 34,270,874 V1543A probably damaging Het
Ell3 A T 2: 121,441,777 I72K probably damaging Het
Fank1 A G 7: 133,862,198 Y41C probably benign Het
Foxd3 T C 4: 99,657,024 Y134H probably damaging Het
Frmd6 A G 12: 70,863,911 probably benign Het
Gale A G 4: 135,965,605 E53G possibly damaging Het
Glis3 A G 19: 28,317,302 S699P probably damaging Het
Gm12830 T A 4: 114,845,049 M136K unknown Het
Grik3 T C 4: 125,659,789 V438A probably benign Het
Gsap A G 5: 21,217,431 N133D probably damaging Het
Gsg1 T A 6: 135,240,112 D239V probably damaging Het
H2-T10 A T 17: 36,121,083 W23R probably damaging Het
Itgae A G 11: 73,140,757 T1100A probably benign Het
Kcnh7 A T 2: 62,777,559 F559L probably damaging Het
Kdm5b G T 1: 134,608,878 R612L probably damaging Het
Lrrc74a T A 12: 86,748,457 N253K possibly damaging Het
Mcm3ap A G 10: 76,515,706 H1961R possibly damaging Het
Ncam1 C T 9: 49,565,004 E262K probably benign Het
Nckap1 A G 2: 80,508,781 S968P possibly damaging Het
Nr2f2 T G 7: 70,359,996 S112R probably benign Het
Nup93 T C 8: 94,286,537 W137R probably damaging Het
Olfr1115 A G 2: 87,252,392 S152G probably benign Het
Olfr1251 A T 2: 89,666,989 L299H probably damaging Het
Olfr1395 A G 11: 49,148,833 D192G possibly damaging Het
Olfr664 A T 7: 104,734,036 F109L probably damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Olfr922 T C 9: 38,816,370 I289T probably damaging Het
Pibf1 A G 14: 99,101,119 S24G probably damaging Het
Pitx2 C T 3: 129,215,842 R130W probably damaging Het
Pkd1l1 T C 11: 8,901,287 N715S probably benign Het
Pou6f2 A T 13: 18,129,154 I123N possibly damaging Het
Prss29 T A 17: 25,320,539 H35Q possibly damaging Het
Ptpn21 A G 12: 98,680,116 F1028L probably benign Het
Ptpn21 A T 12: 98,715,172 Y68N probably damaging Het
Ptprk A G 10: 28,564,103 T856A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl22l1 A G 3: 28,806,527 T13A possibly damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sec14l5 G A 16: 5,176,565 V408I probably damaging Het
Serpina5 T C 12: 104,101,778 S33P possibly damaging Het
Sgip1 A G 4: 102,966,195 N524S probably damaging Het
Shkbp1 C A 7: 27,351,980 R218M probably null Het
Sorcs1 T A 19: 50,181,414 I970F probably damaging Het
Spg11 A G 2: 122,088,262 V962A possibly damaging Het
Sptbn1 A G 11: 30,136,054 M1205T probably damaging Het
Sufu G A 19: 46,473,654 V369M probably damaging Het
Tmem98 T C 11: 80,821,394 F219S probably benign Het
Trim27 T C 13: 21,180,916 probably benign Het
Trim43b T C 9: 89,091,275 E135G possibly damaging Het
Ube2m A G 7: 13,035,888 V110A probably damaging Het
Ugt2b36 A G 5: 87,092,130 V132A probably damaging Het
Usp36 A T 11: 118,277,274 S86T probably damaging Het
Zfp941 A T 7: 140,812,485 D320E probably benign Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2117:Otogl UTSW 10 107858918 missense probably benign 0.06
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6797:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
R7000:Otogl UTSW 10 107779831 missense probably benign
R7075:Otogl UTSW 10 107778929 missense probably benign 0.16
R7122:Otogl UTSW 10 107866654 missense probably benign 0.08
R7176:Otogl UTSW 10 107778911 missense probably damaging 1.00
R7184:Otogl UTSW 10 107763200 missense probably damaging 1.00
R7199:Otogl UTSW 10 107874533 missense possibly damaging 0.88
R7252:Otogl UTSW 10 107821943 missense probably benign 0.06
R7286:Otogl UTSW 10 107770610 missense probably benign 0.00
R7373:Otogl UTSW 10 107901251 missense probably damaging 1.00
R7449:Otogl UTSW 10 107803663 missense probably damaging 1.00
R7486:Otogl UTSW 10 107821988 missense probably damaging 1.00
R7493:Otogl UTSW 10 107886982 missense probably benign 0.06
R7659:Otogl UTSW 10 107777120 missense probably benign 0.19
R7732:Otogl UTSW 10 107806664 missense probably benign 0.01
R7754:Otogl UTSW 10 107869546 missense probably damaging 0.99
R7757:Otogl UTSW 10 107876921 missense probably damaging 1.00
R7800:Otogl UTSW 10 107886515 missense probably damaging 0.99
R7864:Otogl UTSW 10 107869567 missense probably damaging 1.00
R7879:Otogl UTSW 10 107777109 missense probably benign 0.00
R7956:Otogl UTSW 10 107878026 missense possibly damaging 0.62
R7988:Otogl UTSW 10 107895776 missense probably damaging 1.00
R8057:Otogl UTSW 10 107808615 missense probably benign 0.00
R8058:Otogl UTSW 10 107762426 missense probably damaging 1.00
R8127:Otogl UTSW 10 107895752 missense probably damaging 1.00
R8143:Otogl UTSW 10 107806666 missense probably damaging 1.00
R8310:Otogl UTSW 10 107777600 missense possibly damaging 0.94
R8319:Otogl UTSW 10 107853266 critical splice donor site probably null
R8339:Otogl UTSW 10 107789535 missense probably damaging 0.99
R8339:Otogl UTSW 10 107789536 missense probably benign 0.34
R8394:Otogl UTSW 10 107886465 critical splice donor site probably null
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Z1176:Otogl UTSW 10 107777213 missense probably benign
Z1176:Otogl UTSW 10 107778873 missense probably damaging 0.97
Z1176:Otogl UTSW 10 107789032 missense probably benign 0.00
Z1177:Otogl UTSW 10 107763258 nonsense probably null
Z1177:Otogl UTSW 10 107853397 missense possibly damaging 0.78
Z1177:Otogl UTSW 10 107876903 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GTGCTAAGGAGATAGTCAAGTGTTG -3'
(R):5'- GTTCTACCTATTGATTGGTAAGCAC -3'

Sequencing Primer
(F):5'- GGAGATAGTCAAGTGTTGGAGTC -3'
(R):5'- CAAAAGACAACATTGTGGGGTTTTAG -3'
Posted On2018-02-28