Incidental Mutation 'R6226:Itgae'
ID 504354
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Name integrin alpha E, epithelial-associated
Synonyms alpha-E1, CD103
MMRRC Submission 044397-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6226 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 72981409-73038272 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73031583 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1100 (T1100A)
Ref Sequence ENSEMBL: ENSMUSP00000006101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000052140]
AlphaFold Q60677
Predicted Effect probably benign
Transcript: ENSMUST00000006101
AA Change: T1100A

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: T1100A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052140
SMART Domains Protein: ENSMUSP00000055806
Gene: ENSMUSG00000050107

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 357 378 N/A INTRINSIC
SCOP:d1h8fa_ 437 619 1e-8 SMART
DUF3635 664 753 3.83e-45 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,293,853 (GRCm39) T62A probably benign Het
Adam33 G A 2: 130,897,530 (GRCm39) T265I probably damaging Het
Afap1l2 T C 19: 56,904,560 (GRCm39) T654A probably benign Het
Agrn A G 4: 156,258,066 (GRCm39) S992P probably damaging Het
Anapc1 A G 2: 128,492,292 (GRCm39) F939L probably damaging Het
Anks1 G A 17: 28,276,304 (GRCm39) V1016I probably benign Het
Ankzf1 A G 1: 75,173,238 (GRCm39) T401A probably benign Het
Atad1 G T 19: 32,678,987 (GRCm39) D105E probably benign Het
Carmil2 A G 8: 106,415,664 (GRCm39) T313A possibly damaging Het
Cdk15 T C 1: 59,304,792 (GRCm39) V131A probably damaging Het
Cldnd1 A T 16: 58,551,663 (GRCm39) probably null Het
Col16a1 A T 4: 129,948,882 (GRCm39) probably benign Het
Cts3 T A 13: 61,716,535 (GRCm39) I34L probably benign Het
Dnah7b A C 1: 46,165,828 (GRCm39) K498Q probably benign Het
Dnase2b A G 3: 146,290,318 (GRCm39) Y218H probably benign Het
Dsg2 T A 18: 20,712,506 (GRCm39) V170D probably damaging Het
Dst T C 1: 34,309,955 (GRCm39) V1543A probably damaging Het
Ell3 A T 2: 121,272,258 (GRCm39) I72K probably damaging Het
Fank1 A G 7: 133,463,927 (GRCm39) Y41C probably benign Het
Foxd3 T C 4: 99,545,261 (GRCm39) Y134H probably damaging Het
Frmd6 A G 12: 70,910,685 (GRCm39) probably benign Het
Gale A G 4: 135,692,916 (GRCm39) E53G possibly damaging Het
Glis3 A G 19: 28,294,702 (GRCm39) S699P probably damaging Het
Gm12830 T A 4: 114,702,246 (GRCm39) M136K unknown Het
Grik3 T C 4: 125,553,582 (GRCm39) V438A probably benign Het
Gsap A G 5: 21,422,429 (GRCm39) N133D probably damaging Het
Gsg1 T A 6: 135,217,110 (GRCm39) D239V probably damaging Het
H2-T10 A T 17: 36,431,975 (GRCm39) W23R probably damaging Het
Kcnh7 A T 2: 62,607,903 (GRCm39) F559L probably damaging Het
Kdm5b G T 1: 134,536,616 (GRCm39) R612L probably damaging Het
Lrrc74a T A 12: 86,795,231 (GRCm39) N253K possibly damaging Het
Mcm3ap A G 10: 76,351,540 (GRCm39) H1961R possibly damaging Het
Ncam1 C T 9: 49,476,304 (GRCm39) E262K probably benign Het
Nckap1 A G 2: 80,339,125 (GRCm39) S968P possibly damaging Het
Nkapd1 T C 9: 50,519,070 (GRCm39) T181A possibly damaging Het
Nr2f2 T G 7: 70,009,744 (GRCm39) S112R probably benign Het
Nup93 T C 8: 95,013,165 (GRCm39) W137R probably damaging Het
Or10ag53 A G 2: 87,082,736 (GRCm39) S152G probably benign Het
Or2t26 A G 11: 49,039,660 (GRCm39) D192G possibly damaging Het
Or4a78 A T 2: 89,497,333 (GRCm39) L299H probably damaging Het
Or52n1 A T 7: 104,383,243 (GRCm39) F109L probably damaging Het
Or8b12 T A 9: 37,657,433 (GRCm39) M1K probably null Het
Or8b55 T C 9: 38,727,666 (GRCm39) I289T probably damaging Het
Otogl A T 10: 107,607,067 (GRCm39) Y2105* probably null Het
Pibf1 A G 14: 99,338,555 (GRCm39) S24G probably damaging Het
Pitx2 C T 3: 129,009,491 (GRCm39) R130W probably damaging Het
Pkd1l1 T C 11: 8,851,287 (GRCm39) N715S probably benign Het
Pou6f2 A T 13: 18,303,739 (GRCm39) I123N possibly damaging Het
Prss29 T A 17: 25,539,513 (GRCm39) H35Q possibly damaging Het
Ptpn21 A G 12: 98,646,375 (GRCm39) F1028L probably benign Het
Ptpn21 A T 12: 98,681,431 (GRCm39) Y68N probably damaging Het
Ptprk A G 10: 28,440,099 (GRCm39) T856A probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rpl22l1 A G 3: 28,860,676 (GRCm39) T13A possibly damaging Het
Rptn C G 3: 93,305,437 (GRCm39) H923Q possibly damaging Het
Sec14l5 G A 16: 4,994,429 (GRCm39) V408I probably damaging Het
Serpina5 T C 12: 104,068,037 (GRCm39) S33P possibly damaging Het
Sgip1 A G 4: 102,823,392 (GRCm39) N524S probably damaging Het
Shkbp1 C A 7: 27,051,405 (GRCm39) R218M probably null Het
Sorcs1 T A 19: 50,169,852 (GRCm39) I970F probably damaging Het
Spg11 A G 2: 121,918,743 (GRCm39) V962A possibly damaging Het
Sptbn1 A G 11: 30,086,054 (GRCm39) M1205T probably damaging Het
Sufu G A 19: 46,462,093 (GRCm39) V369M probably damaging Het
Tmem98 T C 11: 80,712,220 (GRCm39) F219S probably benign Het
Trim27 T C 13: 21,365,086 (GRCm39) probably benign Het
Trim43b T C 9: 88,973,328 (GRCm39) E135G possibly damaging Het
Ube2m A G 7: 12,769,815 (GRCm39) V110A probably damaging Het
Ugt2b36 A G 5: 87,239,989 (GRCm39) V132A probably damaging Het
Usp36 A T 11: 118,168,100 (GRCm39) S86T probably damaging Het
Zfp941 A T 7: 140,392,398 (GRCm39) D320E probably benign Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73,036,461 (GRCm39) missense probably benign 0.17
IGL00472:Itgae APN 11 73,004,520 (GRCm39) missense probably benign 0.06
IGL00821:Itgae APN 11 73,013,974 (GRCm39) missense probably damaging 1.00
IGL01625:Itgae APN 11 73,010,263 (GRCm39) missense probably benign 0.00
IGL01639:Itgae APN 11 73,010,204 (GRCm39) missense probably benign 0.00
IGL01743:Itgae APN 11 73,002,585 (GRCm39) missense probably benign 0.02
IGL01911:Itgae APN 11 73,006,963 (GRCm39) missense probably damaging 1.00
IGL01949:Itgae APN 11 73,009,010 (GRCm39) missense probably benign 0.29
IGL02149:Itgae APN 11 72,994,720 (GRCm39) missense probably benign 0.04
IGL02179:Itgae APN 11 73,024,844 (GRCm39) missense probably benign 0.06
IGL02231:Itgae APN 11 72,981,448 (GRCm39) missense possibly damaging 0.88
IGL02292:Itgae APN 11 73,009,361 (GRCm39) missense probably damaging 0.98
IGL02378:Itgae APN 11 73,008,947 (GRCm39) missense probably benign 0.00
IGL02525:Itgae APN 11 73,021,777 (GRCm39) missense probably damaging 0.98
IGL02576:Itgae APN 11 73,009,331 (GRCm39) missense possibly damaging 0.95
IGL02729:Itgae APN 11 73,009,029 (GRCm39) splice site probably benign
IGL02859:Itgae APN 11 73,005,693 (GRCm39) missense probably damaging 1.00
IGL03074:Itgae APN 11 73,016,136 (GRCm39) missense probably benign 0.00
IGL03107:Itgae APN 11 73,004,427 (GRCm39) missense probably damaging 1.00
IGL03264:Itgae APN 11 73,006,400 (GRCm39) missense possibly damaging 0.73
IGL03272:Itgae APN 11 73,024,680 (GRCm39) splice site probably null
IGL03352:Itgae APN 11 73,022,556 (GRCm39) missense probably damaging 1.00
R0134:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0225:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0320:Itgae UTSW 11 73,021,825 (GRCm39) missense possibly damaging 0.74
R0344:Itgae UTSW 11 73,008,973 (GRCm39) missense probably benign 0.13
R0403:Itgae UTSW 11 73,014,009 (GRCm39) missense possibly damaging 0.89
R0631:Itgae UTSW 11 73,005,733 (GRCm39) missense probably damaging 1.00
R0833:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0836:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0973:Itgae UTSW 11 73,029,335 (GRCm39) nonsense probably null
R1231:Itgae UTSW 11 73,010,205 (GRCm39) missense probably benign 0.02
R1389:Itgae UTSW 11 73,016,188 (GRCm39) missense probably damaging 1.00
R1433:Itgae UTSW 11 73,006,418 (GRCm39) missense probably damaging 1.00
R1534:Itgae UTSW 11 73,036,431 (GRCm39) missense possibly damaging 0.58
R1833:Itgae UTSW 11 73,007,988 (GRCm39) missense possibly damaging 0.94
R1914:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R1915:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R2061:Itgae UTSW 11 73,009,448 (GRCm39) missense probably benign 0.00
R2380:Itgae UTSW 11 73,036,395 (GRCm39) missense probably benign 0.00
R2435:Itgae UTSW 11 73,012,763 (GRCm39) nonsense probably null
R2680:Itgae UTSW 11 73,005,752 (GRCm39) missense probably damaging 1.00
R2886:Itgae UTSW 11 73,031,513 (GRCm39) missense probably benign 0.04
R3873:Itgae UTSW 11 73,004,442 (GRCm39) missense probably damaging 1.00
R3923:Itgae UTSW 11 73,006,969 (GRCm39) missense probably damaging 0.99
R4010:Itgae UTSW 11 73,002,165 (GRCm39) missense probably benign 0.00
R4059:Itgae UTSW 11 73,002,960 (GRCm39) missense probably benign
R4212:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4213:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4691:Itgae UTSW 11 73,010,345 (GRCm39) nonsense probably null
R4736:Itgae UTSW 11 73,005,706 (GRCm39) missense possibly damaging 0.79
R5152:Itgae UTSW 11 73,021,821 (GRCm39) missense probably damaging 1.00
R5201:Itgae UTSW 11 73,001,382 (GRCm39) missense probably benign 0.00
R5307:Itgae UTSW 11 73,036,464 (GRCm39) missense probably benign 0.00
R5362:Itgae UTSW 11 73,002,675 (GRCm39) missense probably damaging 1.00
R5448:Itgae UTSW 11 73,024,734 (GRCm39) critical splice donor site probably null
R5645:Itgae UTSW 11 73,020,074 (GRCm39) missense probably damaging 1.00
R5672:Itgae UTSW 11 73,036,377 (GRCm39) missense possibly damaging 0.96
R6079:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6138:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6244:Itgae UTSW 11 73,036,427 (GRCm39) missense probably damaging 0.96
R6326:Itgae UTSW 11 73,022,519 (GRCm39) missense possibly damaging 0.88
R6332:Itgae UTSW 11 73,002,228 (GRCm39) splice site probably null
R6502:Itgae UTSW 11 73,036,418 (GRCm39) missense probably benign 0.10
R6825:Itgae UTSW 11 73,009,322 (GRCm39) missense possibly damaging 0.89
R7016:Itgae UTSW 11 73,010,342 (GRCm39) missense probably damaging 0.99
R7020:Itgae UTSW 11 73,002,195 (GRCm39) missense probably damaging 1.00
R7069:Itgae UTSW 11 73,006,969 (GRCm39) missense probably damaging 0.99
R7132:Itgae UTSW 11 73,002,184 (GRCm39) missense possibly damaging 0.93
R7473:Itgae UTSW 11 73,031,504 (GRCm39) missense possibly damaging 0.87
R7599:Itgae UTSW 11 73,012,786 (GRCm39) missense possibly damaging 0.62
R7637:Itgae UTSW 11 73,004,457 (GRCm39) missense probably damaging 1.00
R7763:Itgae UTSW 11 73,014,095 (GRCm39) critical splice donor site probably null
R7829:Itgae UTSW 11 73,029,618 (GRCm39) missense probably benign
R7860:Itgae UTSW 11 73,011,099 (GRCm39) critical splice acceptor site probably null
R7978:Itgae UTSW 11 73,024,913 (GRCm39) missense probably damaging 0.98
R8197:Itgae UTSW 11 73,011,210 (GRCm39) missense probably benign
R8911:Itgae UTSW 11 73,004,447 (GRCm39) missense probably damaging 1.00
R9155:Itgae UTSW 11 73,016,089 (GRCm39) missense possibly damaging 0.94
R9284:Itgae UTSW 11 73,012,752 (GRCm39) missense probably benign 0.25
R9355:Itgae UTSW 11 73,006,906 (GRCm39) missense probably damaging 1.00
R9414:Itgae UTSW 11 73,002,629 (GRCm39) missense possibly damaging 0.59
R9595:Itgae UTSW 11 73,016,182 (GRCm39) missense probably damaging 0.99
R9618:Itgae UTSW 11 73,011,171 (GRCm39) missense possibly damaging 0.78
U15987:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
X0024:Itgae UTSW 11 73,002,202 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1186:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1186:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1187:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1187:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1187:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1188:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1188:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1189:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1189:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1189:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1189:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1190:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1190:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1190:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1191:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1191:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1191:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1191:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1192:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1192:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1192:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GGAACTCTCTAGAAACCGTGAG -3'
(R):5'- GGAAGACAGTTTGTGTACTCAAAG -3'

Sequencing Primer
(F):5'- CGTGAGCTCAAGTCTAAGCCATG -3'
(R):5'- CCTCCTAAGTGCTGGAATTAAAGGC -3'
Posted On 2018-02-28