Incidental Mutation 'R6226:Prss29'
ID504370
Institutional Source Beutler Lab
Gene Symbol Prss29
Ensembl Gene ENSMUSG00000034039
Gene Nameprotease, serine 29
SynonymsIsp2, mISP-2
MMRRC Submission 044397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6226 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25318654-25322681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25320539 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 35 (H35Q)
Ref Sequence ENSEMBL: ENSMUSP00000024993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024993
AA Change: H35Q

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024993
Gene: ENSMUSG00000034039
AA Change: H35Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 30 271 7.11e-89 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T C 13: 12,278,967 T62A probably benign Het
Adam33 G A 2: 131,055,610 T265I probably damaging Het
Afap1l2 T C 19: 56,916,128 T654A probably benign Het
Agrn A G 4: 156,173,609 S992P probably damaging Het
Anapc1 A G 2: 128,650,372 F939L probably damaging Het
Anks1 G A 17: 28,057,330 V1016I probably benign Het
Ankzf1 A G 1: 75,196,594 T401A probably benign Het
Atad1 G T 19: 32,701,587 D105E probably benign Het
AU019823 T C 9: 50,607,770 T181A possibly damaging Het
Carmil2 A G 8: 105,689,032 T313A possibly damaging Het
Cdk15 T C 1: 59,265,633 V131A probably damaging Het
Cldnd1 A T 16: 58,731,300 probably null Het
Col16a1 A T 4: 130,055,089 probably benign Het
Cts3 T A 13: 61,568,721 I34L probably benign Het
Dnah7b A C 1: 46,126,668 K498Q probably benign Het
Dnase2b A G 3: 146,584,563 Y218H probably benign Het
Dsg2 T A 18: 20,579,449 V170D probably damaging Het
Dst T C 1: 34,270,874 V1543A probably damaging Het
Ell3 A T 2: 121,441,777 I72K probably damaging Het
Fank1 A G 7: 133,862,198 Y41C probably benign Het
Foxd3 T C 4: 99,657,024 Y134H probably damaging Het
Frmd6 A G 12: 70,863,911 probably benign Het
Gale A G 4: 135,965,605 E53G possibly damaging Het
Glis3 A G 19: 28,317,302 S699P probably damaging Het
Gm12830 T A 4: 114,845,049 M136K unknown Het
Grik3 T C 4: 125,659,789 V438A probably benign Het
Gsap A G 5: 21,217,431 N133D probably damaging Het
Gsg1 T A 6: 135,240,112 D239V probably damaging Het
H2-T10 A T 17: 36,121,083 W23R probably damaging Het
Itgae A G 11: 73,140,757 T1100A probably benign Het
Kcnh7 A T 2: 62,777,559 F559L probably damaging Het
Kdm5b G T 1: 134,608,878 R612L probably damaging Het
Lrrc74a T A 12: 86,748,457 N253K possibly damaging Het
Mcm3ap A G 10: 76,515,706 H1961R possibly damaging Het
Ncam1 C T 9: 49,565,004 E262K probably benign Het
Nckap1 A G 2: 80,508,781 S968P possibly damaging Het
Nr2f2 T G 7: 70,359,996 S112R probably benign Het
Nup93 T C 8: 94,286,537 W137R probably damaging Het
Olfr1115 A G 2: 87,252,392 S152G probably benign Het
Olfr1251 A T 2: 89,666,989 L299H probably damaging Het
Olfr1395 A G 11: 49,148,833 D192G possibly damaging Het
Olfr664 A T 7: 104,734,036 F109L probably damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Olfr922 T C 9: 38,816,370 I289T probably damaging Het
Otogl A T 10: 107,771,206 Y2105* probably null Het
Pibf1 A G 14: 99,101,119 S24G probably damaging Het
Pitx2 C T 3: 129,215,842 R130W probably damaging Het
Pkd1l1 T C 11: 8,901,287 N715S probably benign Het
Pou6f2 A T 13: 18,129,154 I123N possibly damaging Het
Ptpn21 A G 12: 98,680,116 F1028L probably benign Het
Ptpn21 A T 12: 98,715,172 Y68N probably damaging Het
Ptprk A G 10: 28,564,103 T856A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl22l1 A G 3: 28,806,527 T13A possibly damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sec14l5 G A 16: 5,176,565 V408I probably damaging Het
Serpina5 T C 12: 104,101,778 S33P possibly damaging Het
Sgip1 A G 4: 102,966,195 N524S probably damaging Het
Shkbp1 C A 7: 27,351,980 R218M probably null Het
Sorcs1 T A 19: 50,181,414 I970F probably damaging Het
Spg11 A G 2: 122,088,262 V962A possibly damaging Het
Sptbn1 A G 11: 30,136,054 M1205T probably damaging Het
Sufu G A 19: 46,473,654 V369M probably damaging Het
Tmem98 T C 11: 80,821,394 F219S probably benign Het
Trim27 T C 13: 21,180,916 probably benign Het
Trim43b T C 9: 89,091,275 E135G possibly damaging Het
Ube2m A G 7: 13,035,888 V110A probably damaging Het
Ugt2b36 A G 5: 87,092,130 V132A probably damaging Het
Usp36 A T 11: 118,277,274 S86T probably damaging Het
Zfp941 A T 7: 140,812,485 D320E probably benign Het
Other mutations in Prss29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Prss29 APN 17 25322133 missense probably benign 0.05
IGL01619:Prss29 APN 17 25321139 critical splice donor site probably null
IGL01670:Prss29 APN 17 25322463 missense probably benign 0.03
IGL02516:Prss29 APN 17 25320901 missense probably damaging 1.00
R1538:Prss29 UTSW 17 25320283 start codon destroyed possibly damaging 0.93
R4285:Prss29 UTSW 17 25322257 missense probably damaging 1.00
R5148:Prss29 UTSW 17 25320907 missense probably benign 0.00
R5468:Prss29 UTSW 17 25321046 missense possibly damaging 0.95
R5483:Prss29 UTSW 17 25322203 missense probably benign 0.00
R5852:Prss29 UTSW 17 25322434 missense probably benign 0.01
R6346:Prss29 UTSW 17 25321110 missense possibly damaging 0.83
R7430:Prss29 UTSW 17 25321139 critical splice donor site probably null
R7547:Prss29 UTSW 17 25320922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAGTCCTTATCTCCTGC -3'
(R):5'- CAGCCTTTCTTGGTCCAGAC -3'

Sequencing Primer
(F):5'- GTGAGTCCTTATCTCCTGCACTCC -3'
(R):5'- AGACTTTCTGATTCACCCCCACATC -3'
Posted On2018-02-28