Incidental Mutation 'R6227:4921504E06Rik'
ID504381
Institutional Source Beutler Lab
Gene Symbol 4921504E06Rik
Ensembl Gene ENSMUSG00000026734
Gene NameRIKEN cDNA 4921504E06 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R6227 (G1)
Quality Score209.009
Status Validated
Chromosome2
Chromosomal Location19462837-19553914 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 19553770 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062060]
Predicted Effect probably null
Transcript: ENSMUST00000062060
SMART Domains Protein: ENSMUSP00000058720
Gene: ENSMUSG00000026734

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:DUF4709 36 145 1e-45 PFAM
coiled coil region 165 257 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
coiled coil region 417 463 N/A INTRINSIC
Pfam:DUF4724 477 559 3.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131199
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in 4921504E06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:4921504E06Rik APN 2 19540371 missense probably benign 0.06
IGL01590:4921504E06Rik APN 2 19477779 splice site probably benign
IGL02264:4921504E06Rik APN 2 19542369 splice site probably null
IGL02591:4921504E06Rik APN 2 19480438 missense probably benign 0.26
H8786:4921504E06Rik UTSW 2 19494094 missense probably benign 0.04
R0545:4921504E06Rik UTSW 2 19542376 missense probably damaging 1.00
R0762:4921504E06Rik UTSW 2 19477856 missense probably damaging 0.97
R1325:4921504E06Rik UTSW 2 19495127 missense possibly damaging 0.71
R1456:4921504E06Rik UTSW 2 19480920 critical splice donor site probably null
R2013:4921504E06Rik UTSW 2 19540313 missense probably benign 0.01
R2089:4921504E06Rik UTSW 2 19517546 missense probably damaging 1.00
R2091:4921504E06Rik UTSW 2 19517546 missense probably damaging 1.00
R2091:4921504E06Rik UTSW 2 19517546 missense probably damaging 1.00
R3922:4921504E06Rik UTSW 2 19480560 missense probably benign 0.00
R3982:4921504E06Rik UTSW 2 19542369 splice site probably null
R3983:4921504E06Rik UTSW 2 19542369 splice site probably null
R4074:4921504E06Rik UTSW 2 19480590 missense probably damaging 0.96
R4995:4921504E06Rik UTSW 2 19494184 nonsense probably null
R5303:4921504E06Rik UTSW 2 19516299 missense possibly damaging 0.92
R5308:4921504E06Rik UTSW 2 19524081 missense probably damaging 1.00
R6253:4921504E06Rik UTSW 2 19524118 missense possibly damaging 0.53
R6268:4921504E06Rik UTSW 2 19540408 missense probably benign 0.10
R6496:4921504E06Rik UTSW 2 19540406 missense probably benign 0.17
R7196:4921504E06Rik UTSW 2 19493995 missense probably benign 0.00
R7472:4921504E06Rik UTSW 2 19540408 missense probably benign 0.10
R8146:4921504E06Rik UTSW 2 19494003 missense possibly damaging 0.83
R8150:4921504E06Rik UTSW 2 19533824 missense probably benign 0.10
Z1177:4921504E06Rik UTSW 2 19480532 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTGAAATATTTAACAGGCCCTGTG -3'
(R):5'- TTTCTCTGGGAGTCGCCATG -3'

Sequencing Primer
(F):5'- GAGTAGGCACAATTAGCTACTGTCC -3'
(R):5'- GGCAACGGACTCTGGCTTTG -3'
Posted On2018-02-28