Incidental Mutation 'R6227:Rptn'
ID504387
Institutional Source Beutler Lab
Gene Symbol Rptn
Ensembl Gene ENSMUSG00000041984
Gene Namerepetin
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_009100; MGI: 1099055

Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6227 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location93393699-93399442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 93398130 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 923 (H923Q)
Ref Sequence ENSEMBL: ENSMUSP00000044998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045912]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045912
AA Change: H923Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044998
Gene: ENSMUSG00000041984
AA Change: H923Q

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.2e-13 PFAM
Blast:EFh 53 81 5e-10 BLAST
low complexity region 189 204 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
Blast:CTD 318 461 1e-7 BLAST
low complexity region 1007 1041 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195137
Meta Mutation Damage Score 0.0873 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Rptn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Rptn APN 3 93397182 missense probably benign
IGL01070:Rptn APN 3 93398176 missense possibly damaging 0.86
IGL01625:Rptn APN 3 93397894 missense probably benign 0.18
IGL01678:Rptn APN 3 93396811 missense probably benign 0.00
IGL01716:Rptn APN 3 93396710 missense possibly damaging 0.53
IGL01767:Rptn APN 3 93395639 missense probably benign 0.00
IGL01872:Rptn APN 3 93396847 missense probably benign
IGL02000:Rptn APN 3 93396428 missense probably benign 0.01
IGL02066:Rptn APN 3 93397129 missense probably benign 0.01
IGL02090:Rptn APN 3 93396734 missense possibly damaging 0.85
IGL02116:Rptn APN 3 93395097 missense possibly damaging 0.88
IGL02216:Rptn APN 3 93395773 missense possibly damaging 0.73
IGL02368:Rptn APN 3 93397171 missense probably benign 0.18
IGL02820:Rptn APN 3 93396920 missense probably benign 0.01
IGL03323:Rptn APN 3 93397153 missense probably benign
IGL03404:Rptn APN 3 93398129 missense possibly damaging 0.53
D3080:Rptn UTSW 3 93395828 missense possibly damaging 0.85
H8786:Rptn UTSW 3 93397873 missense possibly damaging 0.53
IGL03097:Rptn UTSW 3 93397373 missense probably damaging 1.00
LCD18:Rptn UTSW 3 93397541 missense probably benign
PIT4431001:Rptn UTSW 3 93397397 small deletion probably benign
PIT4480001:Rptn UTSW 3 93397670 missense possibly damaging 0.85
R1024:Rptn UTSW 3 93398225 missense possibly damaging 0.72
R1119:Rptn UTSW 3 93396245 missense possibly damaging 0.96
R1727:Rptn UTSW 3 93397138 missense possibly damaging 0.73
R1901:Rptn UTSW 3 93396710 missense possibly damaging 0.53
R2247:Rptn UTSW 3 93396829 missense probably benign
R2921:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2922:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R2923:Rptn UTSW 3 93398708 missense possibly damaging 0.96
R3901:Rptn UTSW 3 93398357 missense probably benign
R3936:Rptn UTSW 3 93395576 missense possibly damaging 0.79
R4304:Rptn UTSW 3 93396931 missense probably benign 0.33
R4491:Rptn UTSW 3 93396511 nonsense probably null
R4654:Rptn UTSW 3 93397485 missense possibly damaging 0.53
R4870:Rptn UTSW 3 93396469 nonsense probably null
R5246:Rptn UTSW 3 93396833 missense probably damaging 0.98
R5246:Rptn UTSW 3 93397729 missense possibly damaging 0.53
R5544:Rptn UTSW 3 93398473 missense possibly damaging 0.53
R5555:Rptn UTSW 3 93396701 missense probably benign
R5896:Rptn UTSW 3 93398332 nonsense probably null
R5956:Rptn UTSW 3 93398027 missense possibly damaging 0.53
R6192:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6209:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6224:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6226:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6230:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6247:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6258:Rptn UTSW 3 93398130 missense possibly damaging 0.53
R6393:Rptn UTSW 3 93397199 missense probably benign
R6513:Rptn UTSW 3 93396112 missense possibly damaging 0.73
R6854:Rptn UTSW 3 93398123 missense possibly damaging 0.53
R6855:Rptn UTSW 3 93398251 missense probably benign 0.33
R6884:Rptn UTSW 3 93395789 missense probably benign 0.33
R7018:Rptn UTSW 3 93397900 missense possibly damaging 0.73
R7241:Rptn UTSW 3 93395954 missense probably benign 0.01
R7337:Rptn UTSW 3 93396905 missense probably benign 0.03
R7754:Rptn UTSW 3 93395921 missense probably damaging 0.98
R7794:Rptn UTSW 3 93395729 missense probably benign
R7801:Rptn UTSW 3 93398224 missense possibly damaging 0.53
R8161:Rptn UTSW 3 93396693 small deletion probably benign
R8374:Rptn UTSW 3 93396295 nonsense probably null
X0018:Rptn UTSW 3 93395941 nonsense probably null
Z1088:Rptn UTSW 3 93397427 missense probably benign 0.01
Z1176:Rptn UTSW 3 93395018 missense probably benign 0.26
Z1177:Rptn UTSW 3 93395643 nonsense probably null
Z1177:Rptn UTSW 3 93395712 missense probably benign 0.01
Z1177:Rptn UTSW 3 93397887 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GGCAAAACAGGCACTCTCTAG -3'
(R):5'- ACATGGGTTTGCCTATCACTTG -3'

Sequencing Primer
(F):5'- GCACTCTCTAGGGACTGATAGAAC -3'
(R):5'- GCCTATCACTTGTTTGATGGC -3'
Posted On2018-02-28