Incidental Mutation 'R6227:Abca4'
ID504388
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene NameATP-binding cassette, sub-family A (ABC1), member 4
SynonymsD430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission
Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6227 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location122044443-122180123 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 122137094 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 205 (Y205*)
Ref Sequence ENSEMBL: ENSMUSP00000143560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995] [ENSMUST00000141135]
Predicted Effect probably null
Transcript: ENSMUST00000013995
AA Change: Y1413*
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: Y1413*

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000141135
AA Change: Y205*
SMART Domains Protein: ENSMUSP00000143560
Gene: ENSMUSG00000028125
AA Change: Y205*

DomainStartEndE-ValueType
Blast:AAA 1 172 9e-78 BLAST
Pfam:ABC2_membrane_3 311 686 1.9e-42 PFAM
AAA 755 939 1.2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198484
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 splice site probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 splice site probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense possibly damaging 0.68
R7577:Abca4 UTSW 3 122174014 missense probably damaging 1.00
R7665:Abca4 UTSW 3 122044490 start gained probably benign
R7758:Abca4 UTSW 3 122128167 missense probably damaging 1.00
R7935:Abca4 UTSW 3 122110537 missense possibly damaging 0.85
R8237:Abca4 UTSW 3 122162303 missense probably benign 0.00
R8255:Abca4 UTSW 3 122155277 missense probably benign 0.00
R8294:Abca4 UTSW 3 122103568 missense possibly damaging 0.75
R8504:Abca4 UTSW 3 122129334 missense probably benign 0.01
Z1176:Abca4 UTSW 3 122103488 missense probably damaging 1.00
Z1176:Abca4 UTSW 3 122156443 missense probably damaging 1.00
Z1177:Abca4 UTSW 3 122147786 missense possibly damaging 0.79
Z1177:Abca4 UTSW 3 122173914 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TGCACTGGATGTCTTCCCATG -3'
(R):5'- AAAGATGGAGCTTCAACCCC -3'

Sequencing Primer
(F):5'- CCCATGGGTGTGTATCATCTCTAG -3'
(R):5'- AAGATGGAGCTTCAACCCCCTTTC -3'
Posted On2018-02-28