Incidental Mutation 'R6227:Rlbp1'
ID504398
Institutional Source Beutler Lab
Gene Symbol Rlbp1
Ensembl Gene ENSMUSG00000039194
Gene Nameretinaldehyde binding protein 1
Synonyms3110056M11Rik, CRALBP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6227 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79374870-79387048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79380128 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 119 (N119S)
Ref Sequence ENSEMBL: ENSMUSP00000145850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053718] [ENSMUST00000179243] [ENSMUST00000205442] [ENSMUST00000205638] [ENSMUST00000206162] [ENSMUST00000206320] [ENSMUST00000206695]
Predicted Effect probably benign
Transcript: ENSMUST00000053718
AA Change: N119S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000054545
Gene: ENSMUSG00000039194
AA Change: N119S

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
low complexity region 54 68 N/A INTRINSIC
CRAL_TRIO_N 92 117 1.18e-7 SMART
SEC14 139 294 3.07e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179243
AA Change: N119S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000137143
Gene: ENSMUSG00000039194
AA Change: N119S

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
low complexity region 54 68 N/A INTRINSIC
CRAL_TRIO_N 92 117 1.18e-7 SMART
SEC14 139 294 3.07e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205442
AA Change: N119S

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000205638
Predicted Effect probably benign
Transcript: ENSMUST00000206162
AA Change: N119S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000206320
AA Change: N119S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206624
Predicted Effect probably benign
Transcript: ENSMUST00000206695
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 36-kD water-soluble protein which carries 11-cis-retinaldehyde or 11-cis-retinal as physiologic ligands. It may be a functional component of the visual cycle. Mutations of this gene have been associated with severe rod-cone dystrophy, Bothnia dystrophy (nonsyndromic autosomal recessive retinitis pigmentosa) and retinitis punctata albescens. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display delayed dark adaptation as well as reduced retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Rlbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02435:Rlbp1 APN 7 79381666 missense probably damaging 1.00
IGL02606:Rlbp1 APN 7 79377289 missense possibly damaging 0.70
R1433:Rlbp1 UTSW 7 79383938 missense probably benign 0.05
R1434:Rlbp1 UTSW 7 79379913 splice site probably null
R1540:Rlbp1 UTSW 7 79380060 missense probably damaging 0.98
R1716:Rlbp1 UTSW 7 79375936 missense probably damaging 1.00
R4987:Rlbp1 UTSW 7 79380131 missense probably damaging 1.00
R5228:Rlbp1 UTSW 7 79377334 missense probably damaging 1.00
R6772:Rlbp1 UTSW 7 79384050 intron probably benign
R7086:Rlbp1 UTSW 7 79380065 missense possibly damaging 0.58
R7174:Rlbp1 UTSW 7 79377342 missense possibly damaging 0.88
R7352:Rlbp1 UTSW 7 79381680 missense probably damaging 1.00
R7552:Rlbp1 UTSW 7 79380113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGGGTTCCAACAATAAAGAG -3'
(R):5'- ATTGCCACAAGAGTTAGGGGAC -3'

Sequencing Primer
(F):5'- CGGGGTTCCAACAATAAAGAGTTAGG -3'
(R):5'- GGGACACAGGCCAATCTTATCTTG -3'
Posted On2018-02-28