Incidental Mutation 'R6227:Inppl1'
ID504399
Institutional Source Beutler Lab
Gene Symbol Inppl1
Ensembl Gene ENSMUSG00000032737
Gene Nameinositol polyphosphate phosphatase-like 1
SynonymsSHIP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R6227 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location101822632-101838229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101824299 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1048 (T1048M)
Ref Sequence ENSEMBL: ENSMUSP00000139910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008090] [ENSMUST00000035836] [ENSMUST00000165052] [ENSMUST00000185929]
Predicted Effect probably benign
Transcript: ENSMUST00000008090
SMART Domains Protein: ENSMUSP00000008090
Gene: ENSMUSG00000007946

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
HOX 90 152 5.75e-27 SMART
low complexity region 183 223 N/A INTRINSIC
low complexity region 225 244 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000035836
AA Change: T1048M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048057
Gene: ENSMUSG00000032737
AA Change: T1048M

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165052
AA Change: T1048M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132883
Gene: ENSMUSG00000032737
AA Change: T1048M

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185929
AA Change: T1048M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139910
Gene: ENSMUSG00000032737
AA Change: T1048M

DomainStartEndE-ValueType
SH2 19 108 7.6e-29 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 4e-14 BLAST
IPPc 423 736 1.9e-139 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000186316
AA Change: T467M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209878
Predicted Effect probably benign
Transcript: ENSMUST00000210116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211436
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SH2-containing 5'-inositol phosphatase that is involved in the regulation of insulin function. The encoded protein also plays a role in the regulation of epidermal growth factor receptor turnover and actin remodelling. Additionally, this gene supports metastatic growth in breast cancer and is a valuable biomarker for breast cancer. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mice display decreased postnatal growth, decreased circulating levels of leptin, free fatty acids, triglycerides, and total cholesterol, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Inppl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Inppl1 APN 7 101829158 missense probably damaging 1.00
IGL01633:Inppl1 APN 7 101833834 nonsense probably null
IGL01678:Inppl1 APN 7 101832596 missense probably benign 0.09
IGL02420:Inppl1 APN 7 101832319 unclassified probably benign
IGL02423:Inppl1 APN 7 101832243 missense probably benign 0.02
IGL02965:Inppl1 APN 7 101828271 missense possibly damaging 0.87
IGL03329:Inppl1 APN 7 101824380 missense possibly damaging 0.48
ditzel UTSW 7 101827456 nonsense probably null
PIT4362001:Inppl1 UTSW 7 101826013 missense probably benign 0.34
R0310:Inppl1 UTSW 7 101828499 splice site probably benign
R0355:Inppl1 UTSW 7 101827457 missense probably damaging 1.00
R0394:Inppl1 UTSW 7 101828195 splice site probably benign
R0547:Inppl1 UTSW 7 101831003 missense probably benign 0.02
R0578:Inppl1 UTSW 7 101831588 missense probably damaging 1.00
R1506:Inppl1 UTSW 7 101823967 missense probably benign 0.01
R1526:Inppl1 UTSW 7 101832946 missense probably benign 0.02
R1901:Inppl1 UTSW 7 101823377 missense possibly damaging 0.85
R2381:Inppl1 UTSW 7 101829232 missense probably damaging 1.00
R3690:Inppl1 UTSW 7 101832068 missense probably damaging 0.99
R4911:Inppl1 UTSW 7 101832309 missense possibly damaging 0.94
R5637:Inppl1 UTSW 7 101828848 missense probably benign 0.08
R6409:Inppl1 UTSW 7 101828961 missense probably damaging 1.00
R6678:Inppl1 UTSW 7 101832270 missense probably damaging 0.99
R6752:Inppl1 UTSW 7 101832542 nonsense probably null
R7095:Inppl1 UTSW 7 101827456 nonsense probably null
R7196:Inppl1 UTSW 7 101828786 missense probably benign 0.05
R7421:Inppl1 UTSW 7 101832937 missense probably damaging 0.99
R7575:Inppl1 UTSW 7 101828482 missense probably damaging 1.00
R7664:Inppl1 UTSW 7 101830097 missense probably damaging 0.97
R7767:Inppl1 UTSW 7 101824338 missense probably benign 0.03
R8131:Inppl1 UTSW 7 101830061 missense possibly damaging 0.50
R8206:Inppl1 UTSW 7 101823576 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TTGGCCATTTGCAGTACCG -3'
(R):5'- TTGAAGGGGTCCCACATCAG -3'

Sequencing Primer
(F):5'- GGCCATTTGCAGTACCGAACAAG -3'
(R):5'- GTCCCACATCAGCTGCTG -3'
Posted On2018-02-28