Incidental Mutation 'R6227:Olfr685'
ID504401
Institutional Source Beutler Lab
Gene Symbol Olfr685
Ensembl Gene ENSMUSG00000047794
Gene Nameolfactory receptor 685
SynonymsGA_x6K02T2PBJ9-7810071-7809121, MOR37-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6227 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105178416-105186012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105180710 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 216 (Y216C)
Ref Sequence ENSEMBL: ENSMUSP00000148994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051355] [ENSMUST00000209409] [ENSMUST00000214712] [ENSMUST00000217432]
Predicted Effect probably damaging
Transcript: ENSMUST00000051355
AA Change: Y201C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061561
Gene: ENSMUSG00000047794
AA Change: Y201C

DomainStartEndE-ValueType
Pfam:7tm_4 34 313 3e-107 PFAM
Pfam:7TM_GPCR_Srsx 38 217 2.9e-8 PFAM
Pfam:7tm_1 44 295 7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209409
AA Change: Y216C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214712
AA Change: Y216C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217432
AA Change: Y216C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Olfr685
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Olfr685 APN 7 105180488 missense probably benign 0.00
IGL01612:Olfr685 APN 7 105180722 missense probably damaging 1.00
IGL02598:Olfr685 APN 7 105180956 missense probably damaging 1.00
R0841:Olfr685 UTSW 7 105180854 missense probably damaging 0.96
R1164:Olfr685 UTSW 7 105180833 missense probably benign 0.02
R1711:Olfr685 UTSW 7 105180760 missense probably damaging 0.99
R1891:Olfr685 UTSW 7 105180547 nonsense probably null
R1901:Olfr685 UTSW 7 105180872 missense possibly damaging 0.88
R1990:Olfr685 UTSW 7 105181014 missense probably damaging 1.00
R3766:Olfr685 UTSW 7 105180881 missense probably damaging 0.98
R4750:Olfr685 UTSW 7 105180926 missense probably damaging 1.00
R5056:Olfr685 UTSW 7 105180572 missense probably damaging 1.00
R5061:Olfr685 UTSW 7 105180657 missense possibly damaging 0.56
R7619:Olfr685 UTSW 7 105180749 missense probably damaging 1.00
R8075:Olfr685 UTSW 7 105181136 missense probably damaging 0.98
R8250:Olfr685 UTSW 7 105181311 missense
Predicted Primers PCR Primer
(F):5'- GCCAGCAGAACATGGACATG -3'
(R):5'- CAGGGATTATAGGGCGCATTGG -3'

Sequencing Primer
(F):5'- CATGGTGGCCAAAGCGGTG -3'
(R):5'- CGCATTGGGCTGGTAGTAC -3'
Posted On2018-02-28