Incidental Mutation 'R6227:Trim75'
ID504405
Institutional Source Beutler Lab
Gene Symbol Trim75
Ensembl Gene ENSMUSG00000071089
Gene Nametripartite motif-containing 75
SynonymsLOC333307
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R6227 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location64980884-64987831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64983096 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 234 (H234L)
Ref Sequence ENSEMBL: ENSMUSP00000092932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095295] [ENSMUST00000210982]
Predicted Effect probably benign
Transcript: ENSMUST00000095295
AA Change: H234L

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092932
Gene: ENSMUSG00000071089
AA Change: H234L

DomainStartEndE-ValueType
RING 16 56 5.1e-11 SMART
BBOX 90 131 1.61e-8 SMART
coiled coil region 166 199 N/A INTRINSIC
PRY 293 344 2.12e-8 SMART
Pfam:SPRY 347 459 3.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210982
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Trim75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Trim75 APN 8 64983735 missense possibly damaging 0.61
IGL02959:Trim75 APN 8 64982765 missense possibly damaging 0.71
IGL03026:Trim75 APN 8 64983786 missense probably benign 0.01
IGL03155:Trim75 APN 8 64983340 missense possibly damaging 0.91
IGL03228:Trim75 APN 8 64983354 missense probably benign 0.00
IGL03241:Trim75 APN 8 64982706 missense probably damaging 1.00
R0089:Trim75 UTSW 8 64982928 missense possibly damaging 0.92
R0413:Trim75 UTSW 8 64983240 missense probably benign 0.26
R0523:Trim75 UTSW 8 64983790 missense probably benign 0.05
R1675:Trim75 UTSW 8 64982511 missense probably damaging 0.99
R1721:Trim75 UTSW 8 64982739 splice site probably null
R3861:Trim75 UTSW 8 64982827 missense probably damaging 1.00
R4196:Trim75 UTSW 8 64982764 missense probably damaging 1.00
R4469:Trim75 UTSW 8 64983717 missense probably damaging 1.00
R4740:Trim75 UTSW 8 64982547 missense probably damaging 1.00
R5049:Trim75 UTSW 8 64982439 splice site probably null
R6046:Trim75 UTSW 8 64982883 missense probably damaging 1.00
R6254:Trim75 UTSW 8 64983442 nonsense probably null
R6444:Trim75 UTSW 8 64982836 missense possibly damaging 0.88
R7363:Trim75 UTSW 8 64982887 missense probably damaging 1.00
R7936:Trim75 UTSW 8 64982538 missense probably damaging 1.00
X0019:Trim75 UTSW 8 64983531 missense probably benign 0.00
Z1177:Trim75 UTSW 8 64982661 missense probably damaging 1.00
Z1177:Trim75 UTSW 8 64982941 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGGTCTAGAGTGACGTTGTC -3'
(R):5'- AAAAGAACCGTGACCCTGAG -3'

Sequencing Primer
(F):5'- CTAGAGTGACGTTGTCTGTAAAATGC -3'
(R):5'- GCAGAGGCACAGAGGTCAC -3'
Posted On2018-02-28