Incidental Mutation 'R6227:Mip'
ID504416
Institutional Source Beutler Lab
Gene Symbol Mip
Ensembl Gene ENSMUSG00000025389
Gene Namemajor intrinsic protein of lens fiber
SynonymsAqp0, MIP26, aquaporin 0, shrivelled, lens opacity, Cts, Svl, Lop
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R6227 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128225838-128231812 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 128226006 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 42 (L42*)
Ref Sequence ENSEMBL: ENSMUSP00000026455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026455]
Predicted Effect probably null
Transcript: ENSMUST00000026455
AA Change: L42*
SMART Domains Protein: ENSMUSP00000026455
Gene: ENSMUSG00000025389
AA Change: L42*

DomainStartEndE-ValueType
Pfam:MIP 3 219 5.6e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180407
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major intrinsic protein is a member of the water-transporting aquaporins as well as the original member of the MIP family of channel proteins. The function of the fiber cell membrane protein encoded by this gene is undetermined, yet this protein is speculated to play a role in intracellular communication. The MIP protein is expressed in the ocular lens and is required for correct lens function. This gene has been mapped among aquaporins AQP2, AQP5, and AQP6, in a potential gene cluster at 12q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have microphthalmia and lens opacity. Other defects may include degeneration of lens fiber cells, vacuolization of lens fibers and reduced gamma:alpha crystallin ratio. Heterozygotes have less severe forms of lens cataract and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Mip
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0963:Mip UTSW 10 128225985 missense probably benign 0.00
R1952:Mip UTSW 10 128225903 missense possibly damaging 0.91
R3110:Mip UTSW 10 128226006 nonsense probably null
R3111:Mip UTSW 10 128226006 nonsense probably null
R3112:Mip UTSW 10 128226006 nonsense probably null
R4646:Mip UTSW 10 128227053 missense probably benign 0.00
R4648:Mip UTSW 10 128227053 missense probably benign 0.00
R5650:Mip UTSW 10 128226065 missense possibly damaging 0.74
R8124:Mip UTSW 10 128226201 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTCTATAAAGGGGACTGTCAACC -3'
(R):5'- TAGGTTTCCTCGGACAGCTG -3'

Sequencing Primer
(F):5'- ACTGTCAACCCAGGCAGGTC -3'
(R):5'- TGGGGTGACACTGTACAGCAC -3'
Posted On2018-02-28