Incidental Mutation 'R6227:Olfr816'
ID504417
Institutional Source Beutler Lab
Gene Symbol Olfr816
Ensembl Gene ENSMUSG00000063715
Gene Nameolfactory receptor 816
SynonymsGA_x6K02T2PULF-11590830-11589892, MOR113-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6227 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129909163-129915597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129911667 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 204 (T204S)
Ref Sequence ENSEMBL: ENSMUSP00000149515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071605] [ENSMUST00000213438]
Predicted Effect probably damaging
Transcript: ENSMUST00000071605
AA Change: T204S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071534
Gene: ENSMUSG00000063715
AA Change: T204S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.9e-50 PFAM
Pfam:7tm_1 39 288 1.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213438
AA Change: T204S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213618
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Olfr816
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Olfr816 APN 10 129912245 missense possibly damaging 0.89
IGL01650:Olfr816 APN 10 129911681 missense probably benign 0.00
IGL01766:Olfr816 APN 10 129911780 missense probably damaging 1.00
IGL02738:Olfr816 APN 10 129911331 utr 3 prime probably benign
IGL02824:Olfr816 APN 10 129911696 missense probably damaging 1.00
R0401:Olfr816 UTSW 10 129911916 missense probably benign 0.18
R0688:Olfr816 UTSW 10 129911883 missense probably damaging 0.99
R1589:Olfr816 UTSW 10 129911681 missense probably benign 0.00
R1744:Olfr816 UTSW 10 129911393 missense probably damaging 1.00
R2049:Olfr816 UTSW 10 129912167 missense probably benign 0.30
R3763:Olfr816 UTSW 10 129911445 missense probably damaging 1.00
R3952:Olfr816 UTSW 10 129911636 missense probably benign 0.00
R3971:Olfr816 UTSW 10 129911873 missense probably benign 0.01
R4557:Olfr816 UTSW 10 129911529 missense probably damaging 1.00
R5538:Olfr816 UTSW 10 129912002 missense probably benign 0.13
R6127:Olfr816 UTSW 10 129911415 missense probably damaging 1.00
R6394:Olfr816 UTSW 10 129911920 missense probably damaging 1.00
R6707:Olfr816 UTSW 10 129911739 missense probably benign 0.02
R7257:Olfr816 UTSW 10 129912287 start gained probably benign
R7258:Olfr816 UTSW 10 129912287 start gained probably benign
R7260:Olfr816 UTSW 10 129912287 start gained probably benign
R7409:Olfr816 UTSW 10 129912251 missense possibly damaging 0.74
R7539:Olfr816 UTSW 10 129912063 missense probably damaging 1.00
R7782:Olfr816 UTSW 10 129911523 missense probably damaging 1.00
R7984:Olfr816 UTSW 10 129912072 missense probably benign 0.00
X0019:Olfr816 UTSW 10 129912095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGAGGTATTGAGCACAG -3'
(R):5'- CAGCTGGTCCTCAGTTGTTG -3'

Sequencing Primer
(F):5'- CTGAGGTATTGAGCACAGAAATTCC -3'
(R):5'- TCCTCAGTTGTTGGCTTGC -3'
Posted On2018-02-28