Incidental Mutation 'R6227:Smtn'
ID504418
Institutional Source Beutler Lab
Gene Symbol Smtn
Ensembl Gene ENSMUSG00000020439
Gene Namesmoothelin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R6227 (G1)
Quality Score131.008
Status Validated
Chromosome11
Chromosomal Location3517523-3540612 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 3527624 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020718] [ENSMUST00000020721] [ENSMUST00000075118] [ENSMUST00000110011] [ENSMUST00000136243] [ENSMUST00000156201] [ENSMUST00000170588]
Predicted Effect unknown
Transcript: ENSMUST00000020718
AA Change: V68A
SMART Domains Protein: ENSMUSP00000020718
Gene: ENSMUSG00000020439
AA Change: V68A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
coiled coil region 41 74 N/A INTRINSIC
low complexity region 75 100 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
Pfam:Smoothelin 154 208 1e-23 PFAM
low complexity region 212 236 N/A INTRINSIC
CH 322 421 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020721
SMART Domains Protein: ENSMUSP00000020721
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075118
SMART Domains Protein: ENSMUSP00000074621
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.8e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 907 9.51e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110011
SMART Domains Protein: ENSMUSP00000105638
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.5e-14 PFAM
Pfam:Smoothelin 72 122 8.5e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 568 617 6e-25 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 930 1.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128806
Predicted Effect probably benign
Transcript: ENSMUST00000136243
SMART Domains Protein: ENSMUSP00000117307
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.3e-16 PFAM
Pfam:Smoothelin 68 122 6.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154861
Predicted Effect probably benign
Transcript: ENSMUST00000156201
SMART Domains Protein: ENSMUSP00000118750
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 3.4e-13 PFAM
Pfam:Smoothelin 68 122 1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170588
SMART Domains Protein: ENSMUSP00000133155
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions of both the A and B isoforms of this gene display partial postnatal lethality, impaired intestinal smooth muscle contractility and thus hampered intestinal transit and diverticulosis. Mice lacking only the B isoform appearnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Smtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Smtn APN 11 3526326 critical splice donor site probably null
IGL02335:Smtn APN 11 3526215 missense probably damaging 1.00
IGL02473:Smtn APN 11 3532463 missense probably damaging 1.00
IGL02678:Smtn APN 11 3526353 missense possibly damaging 0.95
IGL02824:Smtn APN 11 3532658 missense probably damaging 1.00
IGL03067:Smtn APN 11 3530165 missense possibly damaging 0.53
IGL03142:Smtn APN 11 3532601 nonsense probably null
runtish UTSW 11 3531326 missense possibly damaging 0.89
R0279:Smtn UTSW 11 3530235 missense probably damaging 0.99
R0523:Smtn UTSW 11 3524664 missense possibly damaging 0.89
R0855:Smtn UTSW 11 3521880 missense probably damaging 1.00
R1080:Smtn UTSW 11 3517693 missense probably damaging 1.00
R1218:Smtn UTSW 11 3530021 missense probably benign
R1571:Smtn UTSW 11 3530102 missense probably benign 0.00
R1899:Smtn UTSW 11 3531326 missense possibly damaging 0.89
R2033:Smtn UTSW 11 3517781 missense probably benign 0.43
R2126:Smtn UTSW 11 3530045 missense probably benign 0.02
R2358:Smtn UTSW 11 3532865 splice site probably null
R3690:Smtn UTSW 11 3527687 intron probably benign
R3712:Smtn UTSW 11 3532865 splice site probably null
R4108:Smtn UTSW 11 3526449 missense probably benign 0.10
R4709:Smtn UTSW 11 3524663 missense probably damaging 0.99
R4710:Smtn UTSW 11 3524663 missense probably damaging 0.99
R4830:Smtn UTSW 11 3520736 intron probably benign
R4944:Smtn UTSW 11 3522916 missense probably damaging 1.00
R4959:Smtn UTSW 11 3527825 start codon destroyed probably null
R5223:Smtn UTSW 11 3529530 missense probably benign 0.00
R5554:Smtn UTSW 11 3520811 nonsense probably null
R5610:Smtn UTSW 11 3529582 missense probably damaging 1.00
R5636:Smtn UTSW 11 3517829 critical splice acceptor site probably null
R5972:Smtn UTSW 11 3533486 missense probably damaging 1.00
R6108:Smtn UTSW 11 3529608 missense probably damaging 0.99
R7016:Smtn UTSW 11 3530368 critical splice donor site probably null
R7423:Smtn UTSW 11 3531200 critical splice donor site probably null
R7426:Smtn UTSW 11 3530249 missense probably benign 0.10
R7447:Smtn UTSW 11 3530196 missense probably benign
R7496:Smtn UTSW 11 3529988 missense probably damaging 0.99
R7716:Smtn UTSW 11 3524708 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACGAGACTGCTCCTTCGAG -3'
(R):5'- GCTGCAGCCTTTGAAGAAC -3'

Sequencing Primer
(F):5'- TCCTTCGAGAGGGGCCC -3'
(R):5'- CTGCAGCCTTTGAAGAACAGTTG -3'
Posted On2018-02-28