Incidental Mutation 'R6227:Zfp213'
ID504430
Institutional Source Beutler Lab
Gene Symbol Zfp213
Ensembl Gene ENSMUSG00000071256
Gene Namezinc finger protein 213
SynonymsD17Ertd197e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6227 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location23556769-23564226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23558022 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 349 (T349A)
Ref Sequence ENSEMBL: ENSMUSP00000093266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088673] [ENSMUST00000095606] [ENSMUST00000182769]
Predicted Effect probably benign
Transcript: ENSMUST00000088673
SMART Domains Protein: ENSMUSP00000086048
Gene: ENSMUSG00000067882

DomainStartEndE-ValueType
Pfam:Peptidase_C14 3 162 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095606
AA Change: T349A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093266
Gene: ENSMUSG00000071256
AA Change: T349A

DomainStartEndE-ValueType
SCAN 41 145 3.11e-56 SMART
KRAB 213 278 3.21e-4 SMART
ZnF_C2H2 326 348 3.89e-3 SMART
ZnF_C2H2 354 376 9.88e-5 SMART
ZnF_C2H2 382 404 6.42e-4 SMART
ZnF_C2H2 410 432 1.95e-3 SMART
ZnF_C2H2 438 460 4.4e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180920
Predicted Effect probably benign
Transcript: ENSMUST00000182769
SMART Domains Protein: ENSMUSP00000138283
Gene: ENSMUSG00000067882

DomainStartEndE-ValueType
Pfam:Peptidase_C14 18 175 1.7e-7 PFAM
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C2H2 zinc finger proteins, such as ZNF213, have bipartite structures in which one domain binds DNA or RNA and the other modulates target gene expression.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Zfp213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp213 APN 17 23561417 missense probably benign 0.18
IGL02302:Zfp213 APN 17 23557971 missense possibly damaging 0.88
ANU18:Zfp213 UTSW 17 23561417 missense probably benign 0.18
R2137:Zfp213 UTSW 17 23559507 synonymous probably null
R4010:Zfp213 UTSW 17 23558090 missense possibly damaging 0.93
R5149:Zfp213 UTSW 17 23561399 missense probably damaging 0.97
R5595:Zfp213 UTSW 17 23561186 missense possibly damaging 0.92
R5979:Zfp213 UTSW 17 23557911 nonsense probably null
R6711:Zfp213 UTSW 17 23559511 missense probably benign
R7105:Zfp213 UTSW 17 23558204 missense probably benign 0.40
R7409:Zfp213 UTSW 17 23559629 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCACGCTGCTTGAAACTC -3'
(R):5'- TATGTCCTGGAATCCCGAGG -3'

Sequencing Primer
(F):5'- TGCAGCTGAAGGGCTTCTC -3'
(R):5'- ATCCCGAGGAGGCTGAGAC -3'
Posted On2018-02-28