Incidental Mutation 'R6227:Adgrf1'
ID504433
Institutional Source Beutler Lab
Gene Symbol Adgrf1
Ensembl Gene ENSMUSG00000041293
Gene Nameadhesion G protein-coupled receptor F1
SynonymsGpr110, 5031409J19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6227 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location43270329-43324737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43310273 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 467 (D467G)
Ref Sequence ENSEMBL: ENSMUSP00000049380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047399]
Predicted Effect probably benign
Transcript: ENSMUST00000047399
AA Change: D467G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000049380
Gene: ENSMUSG00000041293
AA Change: D467G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 59 83 N/A INTRINSIC
Pfam:SEA 150 238 3.7e-10 PFAM
low complexity region 341 363 N/A INTRINSIC
GPS 528 576 5.56e-15 SMART
Pfam:7tm_2 580 832 2.1e-38 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Adgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Adgrf1 APN 17 43313195 missense probably null 0.92
IGL01359:Adgrf1 APN 17 43310686 missense probably damaging 0.99
IGL02131:Adgrf1 APN 17 43303747 missense probably damaging 0.99
IGL02692:Adgrf1 APN 17 43303778 missense probably damaging 1.00
IGL02891:Adgrf1 APN 17 43311161 missense probably damaging 0.96
IGL03027:Adgrf1 APN 17 43296714 missense probably damaging 1.00
IGL03296:Adgrf1 APN 17 43321153 splice site probably benign
R0211:Adgrf1 UTSW 17 43296690 missense probably damaging 1.00
R0211:Adgrf1 UTSW 17 43296690 missense probably damaging 1.00
R0389:Adgrf1 UTSW 17 43303788 critical splice donor site probably null
R0488:Adgrf1 UTSW 17 43310411 missense probably damaging 0.99
R1591:Adgrf1 UTSW 17 43310981 missense probably damaging 1.00
R1817:Adgrf1 UTSW 17 43310033 missense probably benign 0.01
R1819:Adgrf1 UTSW 17 43310033 missense probably benign 0.01
R2009:Adgrf1 UTSW 17 43321221 nonsense probably null
R2032:Adgrf1 UTSW 17 43311275 missense probably damaging 1.00
R2140:Adgrf1 UTSW 17 43300802 missense probably damaging 0.99
R3953:Adgrf1 UTSW 17 43310207 missense probably benign 0.08
R4679:Adgrf1 UTSW 17 43310493 missense probably damaging 1.00
R4775:Adgrf1 UTSW 17 43311163 missense probably damaging 1.00
R4858:Adgrf1 UTSW 17 43303672 missense probably damaging 1.00
R4894:Adgrf1 UTSW 17 43299084 nonsense probably null
R4895:Adgrf1 UTSW 17 43310620 missense probably benign 0.33
R4935:Adgrf1 UTSW 17 43295239 missense probably benign 0.00
R5027:Adgrf1 UTSW 17 43303747 missense probably damaging 0.99
R5373:Adgrf1 UTSW 17 43291005 start gained probably benign
R5374:Adgrf1 UTSW 17 43291005 start gained probably benign
R5455:Adgrf1 UTSW 17 43321143 splice site probably null
R5579:Adgrf1 UTSW 17 43311064 missense probably damaging 1.00
R5985:Adgrf1 UTSW 17 43293255 missense probably benign 0.00
R6038:Adgrf1 UTSW 17 43295209 missense probably benign 0.00
R6038:Adgrf1 UTSW 17 43295209 missense probably benign 0.00
R6160:Adgrf1 UTSW 17 43310687 missense probably damaging 1.00
R6500:Adgrf1 UTSW 17 43310372 missense probably damaging 1.00
R7066:Adgrf1 UTSW 17 43310260 missense probably benign 0.05
R7099:Adgrf1 UTSW 17 43310602 missense probably benign 0.00
R7561:Adgrf1 UTSW 17 43311109 missense possibly damaging 0.94
R8359:Adgrf1 UTSW 17 43310395 missense probably damaging 0.99
Z1177:Adgrf1 UTSW 17 43310147 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGGAAAGCATCAGTAGTCTCATCC -3'
(R):5'- TCCATTGCAACTGGCTAAAATCC -3'

Sequencing Primer
(F):5'- AAAGCATCAGTAGTCTCATCCCTTCC -3'
(R):5'- AGGCTGAGTCAGGTTTCCC -3'
Posted On2018-02-28