Incidental Mutation 'R6227:Pex6'
ID504434
Institutional Source Beutler Lab
Gene Symbol Pex6
Ensembl Gene ENSMUSG00000002763
Gene Nameperoxisomal biogenesis factor 6
SynonymsD130055I09Rik
MMRRC Submission
Accession Numbers

Genbank: NM_145488; Ensembl: ENSMUSP00000002840

Is this an essential gene? Possibly essential (E-score: 0.619) question?
Stock #R6227 (G1)
Quality Score205.009
Status Validated
Chromosome17
Chromosomal Location46711463-46725541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46712108 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 203 (D203E)
Ref Sequence ENSEMBL: ENSMUSP00000002840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002840]
Predicted Effect probably benign
Transcript: ENSMUST00000002840
AA Change: D203E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000002840
Gene: ENSMUSG00000002763
AA Change: D203E

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 112 128 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
AAA 463 598 6.1e-7 SMART
AAA 737 875 6e-24 SMART
Blast:AAA 928 973 1e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) family of ATPases. This member is a predominantly cytoplasmic protein, which plays a direct role in peroxisomal protein import and is required for PTS1 (peroxisomal targeting signal 1, a C-terminal tripeptide of the sequence ser-lys-leu) receptor activity. Mutations in this gene cause peroxisome biogenesis disorders of complementation group 4 and complementation group 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Lactbl1 C A 4: 136,637,918 A527E probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Pex6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Pex6 APN 17 46725304 missense probably benign 0.00
IGL01601:Pex6 APN 17 46723724 missense probably damaging 1.00
IGL01710:Pex6 APN 17 46725326 unclassified probably benign
IGL02392:Pex6 APN 17 46723499 missense probably damaging 1.00
IGL02419:Pex6 APN 17 46724435 missense possibly damaging 0.69
G5030:Pex6 UTSW 17 46715456 intron probably benign
R0091:Pex6 UTSW 17 46711918 missense probably damaging 1.00
R0243:Pex6 UTSW 17 46723737 critical splice donor site probably null
R0732:Pex6 UTSW 17 46724700 missense probably damaging 1.00
R1529:Pex6 UTSW 17 46714064 missense probably benign 0.10
R1602:Pex6 UTSW 17 46712137 missense probably benign 0.09
R1638:Pex6 UTSW 17 46722632 missense probably benign
R1757:Pex6 UTSW 17 46723498 missense probably damaging 1.00
R3769:Pex6 UTSW 17 46724385 splice site probably null
R4684:Pex6 UTSW 17 46712101 missense probably benign 0.01
R4731:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4731:Pex6 UTSW 17 46724707 splice site probably null
R4732:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4732:Pex6 UTSW 17 46724707 splice site probably null
R4733:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4733:Pex6 UTSW 17 46724707 splice site probably null
R4915:Pex6 UTSW 17 46714056 missense probably damaging 0.96
R5996:Pex6 UTSW 17 46714458 splice site probably null
R6156:Pex6 UTSW 17 46720641 missense probably benign 0.02
R7054:Pex6 UTSW 17 46720521 missense probably benign
R7635:Pex6 UTSW 17 46724017 missense probably damaging 1.00
R8034:Pex6 UTSW 17 46722399 missense possibly damaging 0.67
R8177:Pex6 UTSW 17 46714062 missense probably benign
R8330:Pex6 UTSW 17 46712134 missense possibly damaging 0.55
Z1088:Pex6 UTSW 17 46712222 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GATCGCGAGTGTTGGAGAC -3'
(R):5'- GGCAGAAACACCAGTCCGTC -3'

Sequencing Primer
(F):5'- AGTGTTGGAGACGCGACC -3'
(R):5'- ACACCAGTCCGTCAGCGAG -3'
Posted On2018-02-28