Incidental Mutation 'R6228:Olfr1100'
ID504450
Institutional Source Beutler Lab
Gene Symbol Olfr1100
Ensembl Gene ENSMUSG00000070875
Gene Nameolfactory receptor 1100
SynonymsGA_x6K02T2Q125-48465387-48464422, MOR206-4
MMRRC Submission 044357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6228 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86976029-86979954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86978691 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 35 (Y35C)
Ref Sequence ENSEMBL: ENSMUSP00000151088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094913] [ENSMUST00000117211]
Predicted Effect probably damaging
Transcript: ENSMUST00000094913
AA Change: Y35C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092517
Gene: ENSMUSG00000070875
AA Change: Y35C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-51 PFAM
Pfam:7tm_1 41 314 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117211
AA Change: Y35C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (93/93)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 G T 7: 46,030,256 T9K probably benign Het
Ankrd28 T C 14: 31,707,220 H925R probably damaging Het
Antxrl A T 14: 34,056,599 T128S probably damaging Het
Atp8b5 T C 4: 43,304,674 Y62H probably damaging Het
AU019823 A G 9: 50,607,671 S214P possibly damaging Het
Bmpr2 G T 1: 59,867,436 V563L probably benign Het
Btn1a1 A T 13: 23,464,351 L104Q probably damaging Het
Caskin1 C G 17: 24,507,180 D1420E probably damaging Het
Cdc14a A T 3: 116,351,213 I150N probably damaging Het
Cdc26 C T 4: 62,402,794 R4Q probably damaging Het
Cfap46 T C 7: 139,656,580 D160G probably damaging Het
Cxcr4 A C 1: 128,592,183 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dgat1 T C 15: 76,503,293 N317S possibly damaging Het
Disp1 G A 1: 183,099,025 T228M possibly damaging Het
Dixdc1 A C 9: 50,703,356 probably null Het
Dnase1l2 C A 17: 24,442,518 probably benign Het
Dsg2 T C 18: 20,594,293 probably null Het
Duox2 A T 2: 122,287,193 F887I probably benign Het
Efcab6 T C 15: 83,967,624 D351G possibly damaging Het
Ep400 A G 5: 110,670,942 V2621A probably damaging Het
Epg5 G T 18: 77,948,462 V125F possibly damaging Het
Ephb1 T C 9: 101,923,584 R953G probably damaging Het
Etfdh G T 3: 79,612,029 Y272* probably null Het
Fam117b A G 1: 59,969,048 E347G probably damaging Het
Fam214a A G 9: 75,006,363 M100V possibly damaging Het
Gfra3 A T 18: 34,695,793 C183S probably damaging Het
Gm4981 A G 10: 58,235,522 M290T probably benign Het
Gmip A G 8: 69,816,123 D466G probably damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Gpd1 A T 15: 99,723,265 Q320L possibly damaging Het
H2-Oa G T 17: 34,093,877 D43Y probably damaging Het
Hecw1 T A 13: 14,346,038 I205F probably damaging Het
Ighv8-13 A G 12: 115,765,353 Y95H probably damaging Het
Igkv6-20 T C 6: 70,336,097 M31V possibly damaging Het
Itih1 T C 14: 30,931,260 D737G probably benign Het
Kcnc4 G C 3: 107,448,377 H252D probably damaging Het
Kcnj14 T A 7: 45,819,497 T195S probably damaging Het
Limch1 A T 5: 67,016,502 D642V probably damaging Het
Lrp2 T G 2: 69,482,366 D2526A possibly damaging Het
Lrrc8a A G 2: 30,256,553 T460A possibly damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Lypd8 A T 11: 58,386,803 Q137L possibly damaging Het
Mapkapk3 A G 9: 107,260,063 Y206H probably damaging Het
Mrc1 G A 2: 14,271,304 G483D probably benign Het
Mrpl35 C A 6: 71,823,677 probably benign Het
Mycbp2 T A 14: 103,260,229 H936L probably benign Het
Myh3 A T 11: 67,087,486 Y433F probably benign Het
Napb C T 2: 148,698,178 probably null Het
Nbeal1 C A 1: 60,295,924 Q2288K probably benign Het
Ndst3 G A 3: 123,671,652 Q224* probably null Het
Nkd2 A G 13: 73,821,460 S284P probably benign Het
Olfr1448 A T 19: 12,919,937 V124E probably damaging Het
Olfr420 G A 1: 174,152,146 S210N probably benign Het
Olfr714 T C 7: 107,074,136 Y103H probably damaging Het
Pcdhb8 A G 18: 37,356,984 T572A probably benign Het
Pcdhb9 A G 18: 37,402,062 I370V probably benign Het
Pcsk5 T G 19: 17,581,267 E592A possibly damaging Het
Pigc T C 1: 161,970,467 V6A probably benign Het
Pla2g6 T G 15: 79,305,724 I389L probably benign Het
Pnliprp2 T C 19: 58,763,442 probably null Het
Psmb11 T C 14: 54,626,189 V288A probably benign Het
Rapgef5 A G 12: 117,721,663 probably null Het
Rcn3 T C 7: 45,083,296 N316S probably damaging Het
Rgs6 A G 12: 83,065,964 K183E probably damaging Het
Rhoc A G 3: 104,792,981 probably null Het
Serinc5 T C 13: 92,708,108 C453R probably damaging Het
Slc14a1 A C 18: 78,116,399 M93R probably damaging Het
Slc25a3 A T 10: 91,122,228 D83E probably damaging Het
Slc36a3 T C 11: 55,124,951 Y459C probably benign Het
Slc44a5 A T 3: 154,239,163 Y139F probably benign Het
Spag17 A T 3: 100,022,602 Q539L probably benign Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Stard9 A G 2: 120,713,750 Y4450C probably damaging Het
Taf6l C T 19: 8,778,666 R206Q probably benign Het
Tbc1d23 C T 16: 57,182,903 V501I probably damaging Het
Thap2 T C 10: 115,372,846 H123R probably damaging Het
Tlx3 C A 11: 33,202,432 W221L probably benign Het
Tmem262 T A 19: 6,080,537 probably null Het
Tpmt C A 13: 47,027,259 R201S probably benign Het
Trpm6 T C 19: 18,854,291 S1507P probably damaging Het
Ttc9c T C 19: 8,818,483 E64G possibly damaging Het
Ttn A T 2: 76,810,446 S13653T probably damaging Het
Ugt3a1 G T 15: 9,310,640 W336L possibly damaging Het
Vmn1r215 C A 13: 23,076,463 N224K probably benign Het
Vmn2r59 C T 7: 42,042,411 probably null Het
Wdfy3 A G 5: 101,898,429 S1853P possibly damaging Het
Wdr36 A T 18: 32,842,006 Y137F possibly damaging Het
Zdhhc17 T C 10: 110,956,355 D324G probably benign Het
Zfp217 T C 2: 170,119,577 T277A probably benign Het
Zfp451 A G 1: 33,803,138 probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp871 T C 17: 32,775,884 S106G possibly damaging Het
Other mutations in Olfr1100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Olfr1100 APN 2 86977849 nonsense probably null
R0102:Olfr1100 UTSW 2 86978205 missense possibly damaging 0.90
R0477:Olfr1100 UTSW 2 86978223 missense probably damaging 0.99
R0586:Olfr1100 UTSW 2 86978782 missense probably damaging 0.99
R0743:Olfr1100 UTSW 2 86978499 missense probably benign 0.12
R1163:Olfr1100 UTSW 2 86978676 missense probably damaging 1.00
R1640:Olfr1100 UTSW 2 86978619 missense probably damaging 1.00
R2865:Olfr1100 UTSW 2 86978461 missense possibly damaging 0.56
R4478:Olfr1100 UTSW 2 86978218 missense probably benign
R4548:Olfr1100 UTSW 2 86978670 missense probably damaging 0.98
R4618:Olfr1100 UTSW 2 86978274 missense possibly damaging 0.87
R4829:Olfr1100 UTSW 2 86978574 missense probably damaging 0.99
R4858:Olfr1100 UTSW 2 86978349 missense probably damaging 1.00
R5071:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5072:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5073:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5074:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5574:Olfr1100 UTSW 2 86978523 missense probably benign 0.00
R5735:Olfr1100 UTSW 2 86978700 missense probably benign 0.08
R5874:Olfr1100 UTSW 2 86978442 missense probably damaging 0.99
R6689:Olfr1100 UTSW 2 86978154 missense probably benign 0.36
R6979:Olfr1100 UTSW 2 86978233 missense probably damaging 1.00
R7006:Olfr1100 UTSW 2 86977959 missense probably damaging 0.99
R7274:Olfr1100 UTSW 2 86978523 missense probably benign 0.00
R7399:Olfr1100 UTSW 2 86978157 missense probably benign 0.19
R7560:Olfr1100 UTSW 2 86978778 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTCAGCAGCAGCCAAGAGG -3'
(R):5'- AGCTTCTTCATTTACTGGCATGTG -3'

Sequencing Primer
(F):5'- CCAATAAAGGAAATGACTTTTGTGG -3'
(R):5'- CATGTGTGTCAGTAGTACCTATAGAC -3'
Posted On2018-02-28