Incidental Mutation 'R6228:Stard9'
ID 504451
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene Name StAR related lipid transfer domain containing 9
Synonyms 4831403C07Rik, E230025N21Rik, Kif16a, N-3 kinesin
MMRRC Submission 044357-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R6228 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120459602-120562376 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120544231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 4450 (Y4450C)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070420
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110700
SMART Domains Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 102 151 N/A INTRINSIC
low complexity region 154 180 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 786 906 2.4e-48 PFAM
low complexity region 1157 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110701
SMART Domains Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
low complexity region 101 150 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 789 904 2.4e-41 PFAM
low complexity region 1164 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129384
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148285
Predicted Effect probably damaging
Transcript: ENSMUST00000154193
AA Change: Y674C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705
AA Change: Y674C

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180041
AA Change: Y4450C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: Y4450C

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (93/93)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 G T 7: 45,679,680 (GRCm39) T9K probably benign Het
Ankrd28 T C 14: 31,429,177 (GRCm39) H925R probably damaging Het
Antxrl A T 14: 33,778,556 (GRCm39) T128S probably damaging Het
Atosa A G 9: 74,913,645 (GRCm39) M100V possibly damaging Het
Atp8b5 T C 4: 43,304,674 (GRCm39) Y62H probably damaging Het
Bmpr2 G T 1: 59,906,595 (GRCm39) V563L probably benign Het
Btn1a1 A T 13: 23,648,521 (GRCm39) L104Q probably damaging Het
Caskin1 C G 17: 24,726,154 (GRCm39) D1420E probably damaging Het
Cdc14a A T 3: 116,144,862 (GRCm39) I150N probably damaging Het
Cdc26 C T 4: 62,321,031 (GRCm39) R4Q probably damaging Het
Cfap46 T C 7: 139,236,496 (GRCm39) D160G probably damaging Het
Cxcr4 A C 1: 128,519,920 (GRCm39) probably null Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dgat1 T C 15: 76,387,493 (GRCm39) N317S possibly damaging Het
Disp1 G A 1: 182,880,589 (GRCm39) T228M possibly damaging Het
Dixdc1 A C 9: 50,614,656 (GRCm39) probably null Het
Dnase1l2 C A 17: 24,661,492 (GRCm39) probably benign Het
Dsg2 T C 18: 20,727,350 (GRCm39) probably null Het
Duox2 A T 2: 122,117,674 (GRCm39) F887I probably benign Het
Duxf4 A G 10: 58,071,344 (GRCm39) M290T probably benign Het
Efcab6 T C 15: 83,851,825 (GRCm39) D351G possibly damaging Het
Ep400 A G 5: 110,818,808 (GRCm39) V2621A probably damaging Het
Epg5 G T 18: 77,991,677 (GRCm39) V125F possibly damaging Het
Ephb1 T C 9: 101,800,783 (GRCm39) R953G probably damaging Het
Etfdh G T 3: 79,519,336 (GRCm39) Y272* probably null Het
Fam117b A G 1: 60,008,207 (GRCm39) E347G probably damaging Het
Gfra3 A T 18: 34,828,846 (GRCm39) C183S probably damaging Het
Gmip A G 8: 70,268,773 (GRCm39) D466G probably damaging Het
Golga5 G A 12: 102,450,740 (GRCm39) M464I probably benign Het
Gpd1 A T 15: 99,621,146 (GRCm39) Q320L possibly damaging Het
H2-Oa G T 17: 34,312,851 (GRCm39) D43Y probably damaging Het
Hecw1 T A 13: 14,520,623 (GRCm39) I205F probably damaging Het
Ighv8-13 A G 12: 115,728,973 (GRCm39) Y95H probably damaging Het
Igkv6-20 T C 6: 70,313,081 (GRCm39) M31V possibly damaging Het
Itih1 T C 14: 30,653,217 (GRCm39) D737G probably benign Het
Kcnc4 G C 3: 107,355,693 (GRCm39) H252D probably damaging Het
Kcnj14 T A 7: 45,468,921 (GRCm39) T195S probably damaging Het
Limch1 A T 5: 67,173,845 (GRCm39) D642V probably damaging Het
Lrp2 T G 2: 69,312,710 (GRCm39) D2526A possibly damaging Het
Lrrc8a A G 2: 30,146,565 (GRCm39) T460A possibly damaging Het
Lrrn4cl A G 19: 8,829,135 (GRCm39) T38A probably benign Het
Lypd8 A T 11: 58,277,629 (GRCm39) Q137L possibly damaging Het
Mapkapk3 A G 9: 107,137,262 (GRCm39) Y206H probably damaging Het
Mrc1 G A 2: 14,276,115 (GRCm39) G483D probably benign Het
Mrpl35 C A 6: 71,800,661 (GRCm39) probably benign Het
Mycbp2 T A 14: 103,497,665 (GRCm39) H936L probably benign Het
Myh3 A T 11: 66,978,312 (GRCm39) Y433F probably benign Het
Napb C T 2: 148,540,098 (GRCm39) probably null Het
Nbeal1 C A 1: 60,335,083 (GRCm39) Q2288K probably benign Het
Ndst3 G A 3: 123,465,301 (GRCm39) Q224* probably null Het
Nkapd1 A G 9: 50,518,971 (GRCm39) S214P possibly damaging Het
Nkd2 A G 13: 73,969,579 (GRCm39) S284P probably benign Het
Or10a2 T C 7: 106,673,343 (GRCm39) Y103H probably damaging Het
Or5b12 A T 19: 12,897,301 (GRCm39) V124E probably damaging Het
Or6k2 G A 1: 173,979,712 (GRCm39) S210N probably benign Het
Or8h10 T C 2: 86,809,035 (GRCm39) Y35C probably damaging Het
Pcdhb8 A G 18: 37,490,037 (GRCm39) T572A probably benign Het
Pcdhb9 A G 18: 37,535,115 (GRCm39) I370V probably benign Het
Pcsk5 T G 19: 17,558,631 (GRCm39) E592A possibly damaging Het
Pigc T C 1: 161,798,036 (GRCm39) V6A probably benign Het
Pla2g6 T G 15: 79,189,924 (GRCm39) I389L probably benign Het
Pnliprp2 T C 19: 58,751,874 (GRCm39) probably null Het
Psmb11 T C 14: 54,863,646 (GRCm39) V288A probably benign Het
Rapgef5 A G 12: 117,685,398 (GRCm39) probably null Het
Rcn3 T C 7: 44,732,720 (GRCm39) N316S probably damaging Het
Rgs6 A G 12: 83,112,738 (GRCm39) K183E probably damaging Het
Rhoc A G 3: 104,700,297 (GRCm39) probably null Het
Serinc5 T C 13: 92,844,616 (GRCm39) C453R probably damaging Het
Slc14a1 A C 18: 78,159,614 (GRCm39) M93R probably damaging Het
Slc25a3 A T 10: 90,958,090 (GRCm39) D83E probably damaging Het
Slc36a3 T C 11: 55,015,777 (GRCm39) Y459C probably benign Het
Slc44a5 A T 3: 153,944,800 (GRCm39) Y139F probably benign Het
Spag17 A T 3: 99,929,918 (GRCm39) Q539L probably benign Het
Stap2 C T 17: 56,306,976 (GRCm39) V234M probably damaging Het
Taf6l C T 19: 8,756,030 (GRCm39) R206Q probably benign Het
Tbc1d23 C T 16: 57,003,266 (GRCm39) V501I probably damaging Het
Thap2 T C 10: 115,208,751 (GRCm39) H123R probably damaging Het
Tlx3 C A 11: 33,152,432 (GRCm39) W221L probably benign Het
Tmem262 T A 19: 6,130,567 (GRCm39) probably null Het
Tpmt C A 13: 47,180,735 (GRCm39) R201S probably benign Het
Trpm6 T C 19: 18,831,655 (GRCm39) S1507P probably damaging Het
Ttc9c T C 19: 8,795,847 (GRCm39) E64G possibly damaging Het
Ttn A T 2: 76,640,790 (GRCm39) S13653T probably damaging Het
Ugt3a1 G T 15: 9,310,726 (GRCm39) W336L possibly damaging Het
Vmn1r215 C A 13: 23,260,633 (GRCm39) N224K probably benign Het
Vmn2r59 C T 7: 41,691,835 (GRCm39) probably null Het
Wdfy3 A G 5: 102,046,295 (GRCm39) S1853P possibly damaging Het
Wdr36 A T 18: 32,975,059 (GRCm39) Y137F possibly damaging Het
Zdhhc17 T C 10: 110,792,216 (GRCm39) D324G probably benign Het
Zfp217 T C 2: 169,961,497 (GRCm39) T277A probably benign Het
Zfp451 A G 1: 33,842,219 (GRCm39) probably benign Het
Zfp709 TCGACG TCG 8: 72,644,552 (GRCm39) probably benign Het
Zfp871 T C 17: 32,994,858 (GRCm39) S106G possibly damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120,532,328 (GRCm39) missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120,528,960 (GRCm39) missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120,529,200 (GRCm39) missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120,531,849 (GRCm39) missense probably benign 0.04
IGL01394:Stard9 APN 2 120,536,808 (GRCm39) missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120,504,085 (GRCm39) missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120,533,811 (GRCm39) missense probably damaging 1.00
IGL01810:Stard9 APN 2 120,529,565 (GRCm39) missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120,536,927 (GRCm39) missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120,498,497 (GRCm39) missense probably damaging 1.00
IGL02031:Stard9 APN 2 120,532,820 (GRCm39) missense probably benign 0.27
IGL02081:Stard9 APN 2 120,495,391 (GRCm39) missense probably damaging 0.98
IGL02558:Stard9 APN 2 120,527,388 (GRCm39) missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120,529,473 (GRCm39) missense probably damaging 1.00
IGL02873:Stard9 APN 2 120,544,288 (GRCm39) missense probably damaging 1.00
IGL03195:Stard9 APN 2 120,536,283 (GRCm39) missense probably damaging 1.00
IGL03204:Stard9 APN 2 120,536,283 (GRCm39) missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120,526,566 (GRCm39) small insertion probably benign
IGL03014:Stard9 UTSW 2 120,532,675 (GRCm39) unclassified probably benign
PIT4151001:Stard9 UTSW 2 120,533,237 (GRCm39) nonsense probably null
PIT4498001:Stard9 UTSW 2 120,527,916 (GRCm39) missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120,533,982 (GRCm39) missense probably benign
R0027:Stard9 UTSW 2 120,533,982 (GRCm39) missense probably benign
R0038:Stard9 UTSW 2 120,526,313 (GRCm39) missense probably benign
R0049:Stard9 UTSW 2 120,530,300 (GRCm39) missense probably damaging 1.00
R0049:Stard9 UTSW 2 120,530,300 (GRCm39) missense probably damaging 1.00
R0116:Stard9 UTSW 2 120,464,736 (GRCm39) missense probably damaging 0.99
R0398:Stard9 UTSW 2 120,526,788 (GRCm39) missense probably benign 0.03
R0479:Stard9 UTSW 2 120,528,077 (GRCm39) missense probably damaging 1.00
R0556:Stard9 UTSW 2 120,529,404 (GRCm39) missense probably benign 0.09
R0589:Stard9 UTSW 2 120,529,028 (GRCm39) missense probably benign 0.00
R0609:Stard9 UTSW 2 120,536,787 (GRCm39) missense probably damaging 1.00
R0611:Stard9 UTSW 2 120,529,738 (GRCm39) missense probably benign 0.00
R0683:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R0751:Stard9 UTSW 2 120,527,966 (GRCm39) missense probably benign 0.04
R0833:Stard9 UTSW 2 120,527,480 (GRCm39) missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120,527,480 (GRCm39) missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120,531,323 (GRCm39) missense probably damaging 1.00
R0848:Stard9 UTSW 2 120,526,304 (GRCm39) missense probably damaging 1.00
R0849:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R0961:Stard9 UTSW 2 120,523,920 (GRCm39) missense probably benign 0.01
R0993:Stard9 UTSW 2 120,535,650 (GRCm39) missense probably damaging 1.00
R1005:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1006:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1115:Stard9 UTSW 2 120,523,331 (GRCm39) missense probably benign 0.05
R1163:Stard9 UTSW 2 120,526,694 (GRCm39) missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1200:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1331:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1332:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1333:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1334:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1335:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1336:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1338:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1346:Stard9 UTSW 2 120,543,929 (GRCm39) missense probably damaging 1.00
R1370:Stard9 UTSW 2 120,527,958 (GRCm39) missense probably benign 0.11
R1384:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1401:Stard9 UTSW 2 120,543,328 (GRCm39) splice site probably benign
R1416:Stard9 UTSW 2 120,531,453 (GRCm39) missense probably benign 0.00
R1453:Stard9 UTSW 2 120,496,857 (GRCm39) missense probably damaging 1.00
R1468:Stard9 UTSW 2 120,533,678 (GRCm39) missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120,533,678 (GRCm39) missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120,532,533 (GRCm39) missense probably benign 0.09
R1538:Stard9 UTSW 2 120,527,192 (GRCm39) missense probably benign 0.25
R1614:Stard9 UTSW 2 120,528,156 (GRCm39) missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120,534,203 (GRCm39) missense probably benign 0.37
R1658:Stard9 UTSW 2 120,532,023 (GRCm39) missense probably benign 0.02
R1686:Stard9 UTSW 2 120,529,973 (GRCm39) missense probably benign 0.00
R1797:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1803:Stard9 UTSW 2 120,531,970 (GRCm39) missense probably benign 0.24
R1806:Stard9 UTSW 2 120,509,934 (GRCm39) splice site probably null
R1847:Stard9 UTSW 2 120,528,970 (GRCm39) missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120,519,232 (GRCm39) missense probably damaging 1.00
R1892:Stard9 UTSW 2 120,524,189 (GRCm39) missense probably benign 0.01
R1906:Stard9 UTSW 2 120,526,908 (GRCm39) missense probably benign 0.00
R1907:Stard9 UTSW 2 120,544,293 (GRCm39) missense probably damaging 1.00
R1930:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1933:Stard9 UTSW 2 120,529,137 (GRCm39) missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120,531,887 (GRCm39) missense probably benign
R1999:Stard9 UTSW 2 120,523,349 (GRCm39) missense probably damaging 0.99
R2004:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,495,426 (GRCm39) missense possibly damaging 0.90
R2021:Stard9 UTSW 2 120,534,716 (GRCm39) missense probably benign 0.05
R2025:Stard9 UTSW 2 120,532,879 (GRCm39) missense probably benign 0.20
R2190:Stard9 UTSW 2 120,544,601 (GRCm39) missense probably benign 0.22
R2204:Stard9 UTSW 2 120,529,012 (GRCm39) frame shift probably null
R2422:Stard9 UTSW 2 120,530,765 (GRCm39) missense probably benign 0.29
R3401:Stard9 UTSW 2 120,534,170 (GRCm39) missense probably damaging 0.98
R3618:Stard9 UTSW 2 120,529,500 (GRCm39) missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120,529,500 (GRCm39) missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120,544,030 (GRCm39) missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120,528,710 (GRCm39) missense probably benign 0.11
R4022:Stard9 UTSW 2 120,534,636 (GRCm39) missense probably benign 0.05
R4223:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120,532,427 (GRCm39) missense probably benign 0.43
R4382:Stard9 UTSW 2 120,464,703 (GRCm39) missense probably damaging 1.00
R4453:Stard9 UTSW 2 120,528,272 (GRCm39) missense probably benign
R4499:Stard9 UTSW 2 120,530,722 (GRCm39) missense probably benign 0.05
R4524:Stard9 UTSW 2 120,526,926 (GRCm39) missense probably damaging 1.00
R4671:Stard9 UTSW 2 120,529,121 (GRCm39) missense probably damaging 0.98
R4701:Stard9 UTSW 2 120,536,194 (GRCm39) missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120,526,604 (GRCm39) missense probably benign 0.01
R4822:Stard9 UTSW 2 120,526,422 (GRCm39) missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120,533,594 (GRCm39) missense probably benign 0.18
R4863:Stard9 UTSW 2 120,531,341 (GRCm39) missense probably benign 0.00
R4898:Stard9 UTSW 2 120,536,900 (GRCm39) nonsense probably null
R5033:Stard9 UTSW 2 120,523,880 (GRCm39) missense probably benign 0.00
R5087:Stard9 UTSW 2 120,527,500 (GRCm39) nonsense probably null
R5157:Stard9 UTSW 2 120,528,342 (GRCm39) missense probably benign
R5213:Stard9 UTSW 2 120,529,707 (GRCm39) missense probably damaging 1.00
R5237:Stard9 UTSW 2 120,529,839 (GRCm39) missense probably damaging 0.96
R5257:Stard9 UTSW 2 120,529,824 (GRCm39) missense probably damaging 0.99
R5258:Stard9 UTSW 2 120,529,824 (GRCm39) missense probably damaging 0.99
R5273:Stard9 UTSW 2 120,535,568 (GRCm39) missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120,532,428 (GRCm39) missense probably benign 0.43
R5288:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5292:Stard9 UTSW 2 120,529,626 (GRCm39) missense probably benign 0.17
R5328:Stard9 UTSW 2 120,529,711 (GRCm39) missense probably damaging 1.00
R5385:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5386:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5393:Stard9 UTSW 2 120,533,387 (GRCm39) missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120,524,149 (GRCm39) missense probably benign 0.17
R5685:Stard9 UTSW 2 120,535,803 (GRCm39) missense probably damaging 1.00
R5749:Stard9 UTSW 2 120,534,267 (GRCm39) missense probably damaging 1.00
R5780:Stard9 UTSW 2 120,533,877 (GRCm39) missense probably benign 0.02
R5901:Stard9 UTSW 2 120,531,851 (GRCm39) missense probably damaging 1.00
R5941:Stard9 UTSW 2 120,544,039 (GRCm39) missense probably damaging 1.00
R5960:Stard9 UTSW 2 120,530,442 (GRCm39) missense probably benign 0.05
R5966:Stard9 UTSW 2 120,527,580 (GRCm39) missense probably damaging 1.00
R5967:Stard9 UTSW 2 120,537,375 (GRCm39) missense probably damaging 0.99
R6012:Stard9 UTSW 2 120,535,067 (GRCm39) missense probably damaging 1.00
R6019:Stard9 UTSW 2 120,524,196 (GRCm39) frame shift probably null
R6020:Stard9 UTSW 2 120,524,196 (GRCm39) frame shift probably null
R6036:Stard9 UTSW 2 120,530,556 (GRCm39) missense probably benign 0.09
R6036:Stard9 UTSW 2 120,530,556 (GRCm39) missense probably benign 0.09
R6090:Stard9 UTSW 2 120,524,135 (GRCm39) missense probably damaging 0.99
R6192:Stard9 UTSW 2 120,527,241 (GRCm39) missense probably damaging 0.99
R6235:Stard9 UTSW 2 120,544,027 (GRCm39) missense probably damaging 1.00
R6280:Stard9 UTSW 2 120,531,608 (GRCm39) missense probably benign
R6338:Stard9 UTSW 2 120,527,966 (GRCm39) missense probably benign
R6344:Stard9 UTSW 2 120,534,801 (GRCm39) missense probably benign 0.12
R6364:Stard9 UTSW 2 120,543,910 (GRCm39) missense probably damaging 1.00
R6383:Stard9 UTSW 2 120,496,888 (GRCm39) critical splice donor site probably null
R6644:Stard9 UTSW 2 120,526,253 (GRCm39) missense probably benign 0.11
R6747:Stard9 UTSW 2 120,528,864 (GRCm39) missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120,531,740 (GRCm39) missense probably damaging 1.00
R6836:Stard9 UTSW 2 120,530,324 (GRCm39) missense probably benign 0.15
R6861:Stard9 UTSW 2 120,535,667 (GRCm39) missense probably benign 0.09
R6872:Stard9 UTSW 2 120,544,549 (GRCm39) nonsense probably null
R6875:Stard9 UTSW 2 120,527,917 (GRCm39) missense probably benign 0.04
R6915:Stard9 UTSW 2 120,533,111 (GRCm39) missense probably benign 0.00
R6934:Stard9 UTSW 2 120,528,176 (GRCm39) missense probably benign 0.00
R6943:Stard9 UTSW 2 120,532,677 (GRCm39) missense probably benign 0.29
R7009:Stard9 UTSW 2 120,527,672 (GRCm39) missense probably benign 0.37
R7031:Stard9 UTSW 2 120,530,931 (GRCm39) missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120,509,859 (GRCm39) nonsense probably null
R7151:Stard9 UTSW 2 120,526,623 (GRCm39) missense probably benign
R7154:Stard9 UTSW 2 120,535,023 (GRCm39) missense probably benign 0.02
R7154:Stard9 UTSW 2 120,531,795 (GRCm39) missense probably benign 0.00
R7165:Stard9 UTSW 2 120,534,639 (GRCm39) missense probably damaging 1.00
R7260:Stard9 UTSW 2 120,537,419 (GRCm39) missense possibly damaging 0.90
R7270:Stard9 UTSW 2 120,464,755 (GRCm39) nonsense probably null
R7282:Stard9 UTSW 2 120,528,984 (GRCm39) missense probably benign 0.00
R7344:Stard9 UTSW 2 120,535,167 (GRCm39) missense possibly damaging 0.90
R7347:Stard9 UTSW 2 120,497,015 (GRCm39) missense probably benign
R7359:Stard9 UTSW 2 120,528,761 (GRCm39) missense probably damaging 1.00
R7375:Stard9 UTSW 2 120,495,483 (GRCm39) splice site probably null
R7410:Stard9 UTSW 2 120,531,978 (GRCm39) missense probably benign 0.41
R7422:Stard9 UTSW 2 120,532,633 (GRCm39) missense probably benign 0.21
R7475:Stard9 UTSW 2 120,518,591 (GRCm39) missense probably damaging 1.00
R7523:Stard9 UTSW 2 120,530,078 (GRCm39) missense probably benign
R7553:Stard9 UTSW 2 120,524,289 (GRCm39) splice site probably null
R7624:Stard9 UTSW 2 120,518,627 (GRCm39) missense probably benign 0.15
R7761:Stard9 UTSW 2 120,529,860 (GRCm39) missense probably benign 0.00
R7794:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R7819:Stard9 UTSW 2 120,531,465 (GRCm39) missense probably damaging 1.00
R7823:Stard9 UTSW 2 120,532,587 (GRCm39) missense probably damaging 0.96
R7837:Stard9 UTSW 2 120,534,146 (GRCm39) missense probably benign 0.06
R7889:Stard9 UTSW 2 120,534,942 (GRCm39) missense probably benign 0.11
R7905:Stard9 UTSW 2 120,526,562 (GRCm39) missense not run
R7956:Stard9 UTSW 2 120,535,852 (GRCm39) nonsense probably null
R8013:Stard9 UTSW 2 120,518,582 (GRCm39) missense probably damaging 1.00
R8113:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8114:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8116:Stard9 UTSW 2 120,495,420 (GRCm39) nonsense probably null
R8117:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8118:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8170:Stard9 UTSW 2 120,530,529 (GRCm39) missense possibly damaging 0.76
R8300:Stard9 UTSW 2 120,535,250 (GRCm39) missense possibly damaging 0.71
R8333:Stard9 UTSW 2 120,532,270 (GRCm39) missense probably benign 0.00
R8337:Stard9 UTSW 2 120,510,306 (GRCm39) missense probably damaging 1.00
R8536:Stard9 UTSW 2 120,545,140 (GRCm39) missense possibly damaging 0.93
R8682:Stard9 UTSW 2 120,533,796 (GRCm39) missense possibly damaging 0.65
R8696:Stard9 UTSW 2 120,531,595 (GRCm39) missense probably benign 0.02
R8708:Stard9 UTSW 2 120,534,059 (GRCm39) missense probably damaging 1.00
R8732:Stard9 UTSW 2 120,510,442 (GRCm39) missense probably damaging 1.00
R8798:Stard9 UTSW 2 120,535,212 (GRCm39) missense probably benign 0.09
R8807:Stard9 UTSW 2 120,535,932 (GRCm39) missense probably damaging 1.00
R8807:Stard9 UTSW 2 120,535,943 (GRCm39) missense probably damaging 1.00
R8862:Stard9 UTSW 2 120,534,099 (GRCm39) missense probably benign
R8920:Stard9 UTSW 2 120,533,088 (GRCm39) missense probably damaging 0.96
R9026:Stard9 UTSW 2 120,536,283 (GRCm39) missense probably damaging 1.00
R9048:Stard9 UTSW 2 120,508,415 (GRCm39) missense probably damaging 0.99
R9049:Stard9 UTSW 2 120,510,418 (GRCm39) missense probably benign 0.30
R9152:Stard9 UTSW 2 120,529,068 (GRCm39) missense probably damaging 0.99
R9189:Stard9 UTSW 2 120,533,500 (GRCm39) missense possibly damaging 0.95
R9238:Stard9 UTSW 2 120,528,447 (GRCm39) missense probably damaging 1.00
R9372:Stard9 UTSW 2 120,495,420 (GRCm39) nonsense probably null
R9393:Stard9 UTSW 2 120,518,656 (GRCm39) missense possibly damaging 0.88
R9444:Stard9 UTSW 2 120,495,414 (GRCm39) missense probably damaging 1.00
R9514:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9515:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9516:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9570:Stard9 UTSW 2 120,534,714 (GRCm39) missense probably benign 0.02
R9649:Stard9 UTSW 2 120,526,635 (GRCm39) missense probably benign 0.20
R9789:Stard9 UTSW 2 120,510,417 (GRCm39) missense probably damaging 1.00
X0023:Stard9 UTSW 2 120,533,444 (GRCm39) missense possibly damaging 0.92
X0023:Stard9 UTSW 2 120,533,225 (GRCm39) missense probably benign 0.00
Z1176:Stard9 UTSW 2 120,528,803 (GRCm39) missense probably damaging 1.00
Z1176:Stard9 UTSW 2 120,527,093 (GRCm39) missense probably benign
Z1176:Stard9 UTSW 2 120,526,299 (GRCm39) missense probably benign 0.01
Z1177:Stard9 UTSW 2 120,504,157 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAAGCTTCCAAAGGCCTG -3'
(R):5'- TGAGTCCTGCCTGTGTAATGAC -3'

Sequencing Primer
(F):5'- TTCCAAAGGCCTGGCAGG -3'
(R):5'- GAGTCCTGCCTGTGTAATGACAAAAC -3'
Posted On 2018-02-28