Incidental Mutation 'R6228:Stard9'
ID 504451
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene Name START domain containing 9
Synonyms E230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
MMRRC Submission 044357-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R6228 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120629121-120731895 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120713750 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 4450 (Y4450C)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070420
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110700
SMART Domains Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 102 151 N/A INTRINSIC
low complexity region 154 180 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 786 906 2.4e-48 PFAM
low complexity region 1157 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110701
SMART Domains Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284

DomainStartEndE-ValueType
low complexity region 77 98 N/A INTRINSIC
low complexity region 101 150 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
low complexity region 724 735 N/A INTRINSIC
Pfam:Codanin-1_C 789 904 2.4e-41 PFAM
low complexity region 1164 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129384
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148285
Predicted Effect probably damaging
Transcript: ENSMUST00000154193
AA Change: Y674C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705
AA Change: Y674C

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180041
AA Change: Y4450C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: Y4450C

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (93/93)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 G T 7: 46,030,256 T9K probably benign Het
Ankrd28 T C 14: 31,707,220 H925R probably damaging Het
Antxrl A T 14: 34,056,599 T128S probably damaging Het
Atp8b5 T C 4: 43,304,674 Y62H probably damaging Het
AU019823 A G 9: 50,607,671 S214P possibly damaging Het
Bmpr2 G T 1: 59,867,436 V563L probably benign Het
Btn1a1 A T 13: 23,464,351 L104Q probably damaging Het
Caskin1 C G 17: 24,507,180 D1420E probably damaging Het
Cdc14a A T 3: 116,351,213 I150N probably damaging Het
Cdc26 C T 4: 62,402,794 R4Q probably damaging Het
Cfap46 T C 7: 139,656,580 D160G probably damaging Het
Cxcr4 A C 1: 128,592,183 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dgat1 T C 15: 76,503,293 N317S possibly damaging Het
Disp1 G A 1: 183,099,025 T228M possibly damaging Het
Dixdc1 A C 9: 50,703,356 probably null Het
Dnase1l2 C A 17: 24,442,518 probably benign Het
Dsg2 T C 18: 20,594,293 probably null Het
Duox2 A T 2: 122,287,193 F887I probably benign Het
Efcab6 T C 15: 83,967,624 D351G possibly damaging Het
Ep400 A G 5: 110,670,942 V2621A probably damaging Het
Epg5 G T 18: 77,948,462 V125F possibly damaging Het
Ephb1 T C 9: 101,923,584 R953G probably damaging Het
Etfdh G T 3: 79,612,029 Y272* probably null Het
Fam117b A G 1: 59,969,048 E347G probably damaging Het
Fam214a A G 9: 75,006,363 M100V possibly damaging Het
Gfra3 A T 18: 34,695,793 C183S probably damaging Het
Gm4981 A G 10: 58,235,522 M290T probably benign Het
Gmip A G 8: 69,816,123 D466G probably damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Gpd1 A T 15: 99,723,265 Q320L possibly damaging Het
H2-Oa G T 17: 34,093,877 D43Y probably damaging Het
Hecw1 T A 13: 14,346,038 I205F probably damaging Het
Ighv8-13 A G 12: 115,765,353 Y95H probably damaging Het
Igkv6-20 T C 6: 70,336,097 M31V possibly damaging Het
Itih1 T C 14: 30,931,260 D737G probably benign Het
Kcnc4 G C 3: 107,448,377 H252D probably damaging Het
Kcnj14 T A 7: 45,819,497 T195S probably damaging Het
Limch1 A T 5: 67,016,502 D642V probably damaging Het
Lrp2 T G 2: 69,482,366 D2526A possibly damaging Het
Lrrc8a A G 2: 30,256,553 T460A possibly damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Lypd8 A T 11: 58,386,803 Q137L possibly damaging Het
Mapkapk3 A G 9: 107,260,063 Y206H probably damaging Het
Mrc1 G A 2: 14,271,304 G483D probably benign Het
Mrpl35 C A 6: 71,823,677 probably benign Het
Mycbp2 T A 14: 103,260,229 H936L probably benign Het
Myh3 A T 11: 67,087,486 Y433F probably benign Het
Napb C T 2: 148,698,178 probably null Het
Nbeal1 C A 1: 60,295,924 Q2288K probably benign Het
Ndst3 G A 3: 123,671,652 Q224* probably null Het
Nkd2 A G 13: 73,821,460 S284P probably benign Het
Olfr1100 T C 2: 86,978,691 Y35C probably damaging Het
Olfr1448 A T 19: 12,919,937 V124E probably damaging Het
Olfr420 G A 1: 174,152,146 S210N probably benign Het
Olfr714 T C 7: 107,074,136 Y103H probably damaging Het
Pcdhb8 A G 18: 37,356,984 T572A probably benign Het
Pcdhb9 A G 18: 37,402,062 I370V probably benign Het
Pcsk5 T G 19: 17,581,267 E592A possibly damaging Het
Pigc T C 1: 161,970,467 V6A probably benign Het
Pla2g6 T G 15: 79,305,724 I389L probably benign Het
Pnliprp2 T C 19: 58,763,442 probably null Het
Psmb11 T C 14: 54,626,189 V288A probably benign Het
Rapgef5 A G 12: 117,721,663 probably null Het
Rcn3 T C 7: 45,083,296 N316S probably damaging Het
Rgs6 A G 12: 83,065,964 K183E probably damaging Het
Rhoc A G 3: 104,792,981 probably null Het
Serinc5 T C 13: 92,708,108 C453R probably damaging Het
Slc14a1 A C 18: 78,116,399 M93R probably damaging Het
Slc25a3 A T 10: 91,122,228 D83E probably damaging Het
Slc36a3 T C 11: 55,124,951 Y459C probably benign Het
Slc44a5 A T 3: 154,239,163 Y139F probably benign Het
Spag17 A T 3: 100,022,602 Q539L probably benign Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Taf6l C T 19: 8,778,666 R206Q probably benign Het
Tbc1d23 C T 16: 57,182,903 V501I probably damaging Het
Thap2 T C 10: 115,372,846 H123R probably damaging Het
Tlx3 C A 11: 33,202,432 W221L probably benign Het
Tmem262 T A 19: 6,080,537 probably null Het
Tpmt C A 13: 47,027,259 R201S probably benign Het
Trpm6 T C 19: 18,854,291 S1507P probably damaging Het
Ttc9c T C 19: 8,818,483 E64G possibly damaging Het
Ttn A T 2: 76,810,446 S13653T probably damaging Het
Ugt3a1 G T 15: 9,310,640 W336L possibly damaging Het
Vmn1r215 C A 13: 23,076,463 N224K probably benign Het
Vmn2r59 C T 7: 42,042,411 probably null Het
Wdfy3 A G 5: 101,898,429 S1853P possibly damaging Het
Wdr36 A T 18: 32,842,006 Y137F possibly damaging Het
Zdhhc17 T C 10: 110,956,355 D324G probably benign Het
Zfp217 T C 2: 170,119,577 T277A probably benign Het
Zfp451 A G 1: 33,803,138 probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp871 T C 17: 32,775,884 S106G possibly damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120701847 missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120698479 missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120698719 missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120701368 missense probably benign 0.04
IGL01394:Stard9 APN 2 120706327 missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120673604 missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120703330 missense probably damaging 1.00
IGL01810:Stard9 APN 2 120699084 missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120706446 missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120668016 missense probably damaging 1.00
IGL02031:Stard9 APN 2 120702339 missense probably benign 0.27
IGL02081:Stard9 APN 2 120664910 missense probably damaging 0.98
IGL02558:Stard9 APN 2 120696907 missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120698992 missense probably damaging 1.00
IGL02873:Stard9 APN 2 120713807 missense probably damaging 1.00
IGL03195:Stard9 APN 2 120705802 missense probably damaging 1.00
IGL03204:Stard9 APN 2 120705802 missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120696085 small insertion probably benign
IGL03014:Stard9 UTSW 2 120702194 unclassified probably benign
PIT4151001:Stard9 UTSW 2 120702756 nonsense probably null
PIT4498001:Stard9 UTSW 2 120697435 missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0038:Stard9 UTSW 2 120695832 missense probably benign
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0116:Stard9 UTSW 2 120634255 missense probably damaging 0.99
R0398:Stard9 UTSW 2 120696307 missense probably benign 0.03
R0479:Stard9 UTSW 2 120697596 missense probably damaging 1.00
R0556:Stard9 UTSW 2 120698923 missense probably benign 0.09
R0589:Stard9 UTSW 2 120698547 missense probably benign 0.00
R0609:Stard9 UTSW 2 120706306 missense probably damaging 1.00
R0611:Stard9 UTSW 2 120699257 missense probably benign 0.00
R0683:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0751:Stard9 UTSW 2 120697485 missense probably benign 0.04
R0833:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120700842 missense probably damaging 1.00
R0848:Stard9 UTSW 2 120695823 missense probably damaging 1.00
R0849:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0961:Stard9 UTSW 2 120693439 missense probably benign 0.01
R0993:Stard9 UTSW 2 120705169 missense probably damaging 1.00
R1005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1006:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1115:Stard9 UTSW 2 120692850 missense probably benign 0.05
R1163:Stard9 UTSW 2 120696213 missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1200:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1331:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1332:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1333:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1334:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1335:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1336:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1338:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1346:Stard9 UTSW 2 120713448 missense probably damaging 1.00
R1370:Stard9 UTSW 2 120697477 missense probably benign 0.11
R1384:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1401:Stard9 UTSW 2 120712847 splice site probably benign
R1416:Stard9 UTSW 2 120700972 missense probably benign 0.00
R1453:Stard9 UTSW 2 120666376 missense probably damaging 1.00
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120702052 missense probably benign 0.09
R1538:Stard9 UTSW 2 120696711 missense probably benign 0.25
R1614:Stard9 UTSW 2 120697675 missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120703722 missense probably benign 0.37
R1658:Stard9 UTSW 2 120701542 missense probably benign 0.02
R1686:Stard9 UTSW 2 120699492 missense probably benign 0.00
R1797:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1803:Stard9 UTSW 2 120701489 missense probably benign 0.24
R1806:Stard9 UTSW 2 120679453 splice site probably null
R1847:Stard9 UTSW 2 120698489 missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120688751 missense probably damaging 1.00
R1892:Stard9 UTSW 2 120693708 missense probably benign 0.01
R1906:Stard9 UTSW 2 120696427 missense probably benign 0.00
R1907:Stard9 UTSW 2 120713812 missense probably damaging 1.00
R1930:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1933:Stard9 UTSW 2 120698656 missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120701406 missense probably benign
R1999:Stard9 UTSW 2 120692868 missense probably damaging 0.99
R2004:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2005:Stard9 UTSW 2 120664945 missense possibly damaging 0.90
R2005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2021:Stard9 UTSW 2 120704235 missense probably benign 0.05
R2025:Stard9 UTSW 2 120702398 missense probably benign 0.20
R2190:Stard9 UTSW 2 120714120 missense probably benign 0.22
R2204:Stard9 UTSW 2 120698531 frame shift probably null
R2422:Stard9 UTSW 2 120700284 missense probably benign 0.29
R3401:Stard9 UTSW 2 120703689 missense probably damaging 0.98
R3618:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120713549 missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120698229 missense probably benign 0.11
R4022:Stard9 UTSW 2 120704155 missense probably benign 0.05
R4223:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120701946 missense probably benign 0.43
R4382:Stard9 UTSW 2 120634222 missense probably damaging 1.00
R4453:Stard9 UTSW 2 120697791 missense probably benign
R4499:Stard9 UTSW 2 120700241 missense probably benign 0.05
R4524:Stard9 UTSW 2 120696445 missense probably damaging 1.00
R4671:Stard9 UTSW 2 120698640 missense probably damaging 0.98
R4701:Stard9 UTSW 2 120705713 missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120696123 missense probably benign 0.01
R4822:Stard9 UTSW 2 120695941 missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120703113 missense probably benign 0.18
R4863:Stard9 UTSW 2 120700860 missense probably benign 0.00
R4898:Stard9 UTSW 2 120706419 nonsense probably null
R5033:Stard9 UTSW 2 120693399 missense probably benign 0.00
R5087:Stard9 UTSW 2 120697019 nonsense probably null
R5157:Stard9 UTSW 2 120697861 missense probably benign
R5213:Stard9 UTSW 2 120699226 missense probably damaging 1.00
R5237:Stard9 UTSW 2 120699358 missense probably damaging 0.96
R5257:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5258:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5273:Stard9 UTSW 2 120705087 missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120701947 missense probably benign 0.43
R5288:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5292:Stard9 UTSW 2 120699145 missense probably benign 0.17
R5328:Stard9 UTSW 2 120699230 missense probably damaging 1.00
R5385:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5386:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5393:Stard9 UTSW 2 120702906 missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120693668 missense probably benign 0.17
R5685:Stard9 UTSW 2 120705322 missense probably damaging 1.00
R5749:Stard9 UTSW 2 120703786 missense probably damaging 1.00
R5780:Stard9 UTSW 2 120703396 missense probably benign 0.02
R5901:Stard9 UTSW 2 120701370 missense probably damaging 1.00
R5941:Stard9 UTSW 2 120713558 missense probably damaging 1.00
R5960:Stard9 UTSW 2 120699961 missense probably benign 0.05
R5966:Stard9 UTSW 2 120697099 missense probably damaging 1.00
R5967:Stard9 UTSW 2 120706894 missense probably damaging 0.99
R6012:Stard9 UTSW 2 120704586 missense probably damaging 1.00
R6019:Stard9 UTSW 2 120693715 frame shift probably null
R6020:Stard9 UTSW 2 120693715 frame shift probably null
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6090:Stard9 UTSW 2 120693654 missense probably damaging 0.99
R6192:Stard9 UTSW 2 120696760 missense probably damaging 0.99
R6235:Stard9 UTSW 2 120713546 missense probably damaging 1.00
R6280:Stard9 UTSW 2 120701127 missense probably benign
R6338:Stard9 UTSW 2 120697485 missense probably benign
R6344:Stard9 UTSW 2 120704320 missense probably benign 0.12
R6364:Stard9 UTSW 2 120713429 missense probably damaging 1.00
R6383:Stard9 UTSW 2 120666407 critical splice donor site probably null
R6644:Stard9 UTSW 2 120695772 missense probably benign 0.11
R6747:Stard9 UTSW 2 120698383 missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120701259 missense probably damaging 1.00
R6836:Stard9 UTSW 2 120699843 missense probably benign 0.15
R6861:Stard9 UTSW 2 120705186 missense probably benign 0.09
R6872:Stard9 UTSW 2 120714068 nonsense probably null
R6875:Stard9 UTSW 2 120697436 missense probably benign 0.04
R6915:Stard9 UTSW 2 120702630 missense probably benign 0.00
R6934:Stard9 UTSW 2 120697695 missense probably benign 0.00
R6943:Stard9 UTSW 2 120702196 missense probably benign 0.29
R7009:Stard9 UTSW 2 120697191 missense probably benign 0.37
R7031:Stard9 UTSW 2 120700450 missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120679378 nonsense probably null
R7151:Stard9 UTSW 2 120696142 missense probably benign
R7154:Stard9 UTSW 2 120701314 missense probably benign 0.00
R7154:Stard9 UTSW 2 120704542 missense probably benign 0.02
R7165:Stard9 UTSW 2 120704158 missense probably damaging 1.00
R7260:Stard9 UTSW 2 120706938 missense possibly damaging 0.90
R7270:Stard9 UTSW 2 120634274 nonsense probably null
R7282:Stard9 UTSW 2 120698503 missense probably benign 0.00
R7344:Stard9 UTSW 2 120704686 missense possibly damaging 0.90
R7347:Stard9 UTSW 2 120666534 missense probably benign
R7359:Stard9 UTSW 2 120698280 missense probably damaging 1.00
R7375:Stard9 UTSW 2 120665002 splice site probably null
R7410:Stard9 UTSW 2 120701497 missense probably benign 0.41
R7422:Stard9 UTSW 2 120702152 missense probably benign 0.21
R7475:Stard9 UTSW 2 120688110 missense probably damaging 1.00
R7523:Stard9 UTSW 2 120699597 missense probably benign
R7553:Stard9 UTSW 2 120693808 splice site probably null
R7624:Stard9 UTSW 2 120688146 missense probably benign 0.15
R7761:Stard9 UTSW 2 120699379 missense probably benign 0.00
R7794:Stard9 UTSW 2 120704430 missense probably benign 0.01
R7819:Stard9 UTSW 2 120700984 missense probably damaging 1.00
R7823:Stard9 UTSW 2 120702106 missense probably damaging 0.96
R7837:Stard9 UTSW 2 120703665 missense probably benign 0.06
R7889:Stard9 UTSW 2 120704461 missense probably benign 0.11
R7905:Stard9 UTSW 2 120696081 missense not run
R7956:Stard9 UTSW 2 120705371 nonsense probably null
R8013:Stard9 UTSW 2 120688101 missense probably damaging 1.00
R8113:Stard9 UTSW 2 120704430 missense probably benign 0.01
R8114:Stard9 UTSW 2 120704430 missense probably benign 0.01
R8116:Stard9 UTSW 2 120664939 nonsense probably null
R8117:Stard9 UTSW 2 120704430 missense probably benign 0.01
R8118:Stard9 UTSW 2 120704430 missense probably benign 0.01
R8170:Stard9 UTSW 2 120700048 missense possibly damaging 0.76
R8300:Stard9 UTSW 2 120704769 missense possibly damaging 0.71
R8333:Stard9 UTSW 2 120701789 missense probably benign 0.00
R8337:Stard9 UTSW 2 120679825 missense probably damaging 1.00
R8536:Stard9 UTSW 2 120714659 missense possibly damaging 0.93
R8682:Stard9 UTSW 2 120703315 missense possibly damaging 0.65
R8696:Stard9 UTSW 2 120701114 missense probably benign 0.02
R8708:Stard9 UTSW 2 120703578 missense probably damaging 1.00
R8732:Stard9 UTSW 2 120679961 missense probably damaging 1.00
R8798:Stard9 UTSW 2 120704731 missense probably benign 0.09
R8807:Stard9 UTSW 2 120705451 missense probably damaging 1.00
R8807:Stard9 UTSW 2 120705462 missense probably damaging 1.00
R8862:Stard9 UTSW 2 120703618 missense probably benign
R8920:Stard9 UTSW 2 120702607 missense probably damaging 0.96
R9026:Stard9 UTSW 2 120705802 missense probably damaging 1.00
R9048:Stard9 UTSW 2 120677934 missense probably damaging 0.99
R9049:Stard9 UTSW 2 120679937 missense probably benign 0.30
R9152:Stard9 UTSW 2 120698587 missense probably damaging 0.99
R9189:Stard9 UTSW 2 120703019 missense possibly damaging 0.95
R9238:Stard9 UTSW 2 120697966 missense probably damaging 1.00
R9372:Stard9 UTSW 2 120664939 nonsense probably null
R9393:Stard9 UTSW 2 120688175 missense possibly damaging 0.88
R9444:Stard9 UTSW 2 120664933 missense probably damaging 1.00
R9514:Stard9 UTSW 2 120704083 missense probably damaging 1.00
R9515:Stard9 UTSW 2 120704083 missense probably damaging 1.00
R9516:Stard9 UTSW 2 120704083 missense probably damaging 1.00
R9570:Stard9 UTSW 2 120704233 missense probably benign 0.02
R9649:Stard9 UTSW 2 120696154 missense probably benign 0.20
R9789:Stard9 UTSW 2 120679936 missense probably damaging 1.00
X0023:Stard9 UTSW 2 120702744 missense probably benign 0.00
X0023:Stard9 UTSW 2 120702963 missense possibly damaging 0.92
Z1176:Stard9 UTSW 2 120695818 missense probably benign 0.01
Z1176:Stard9 UTSW 2 120696612 missense probably benign
Z1176:Stard9 UTSW 2 120698322 missense probably damaging 1.00
Z1177:Stard9 UTSW 2 120673676 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAAGCTTCCAAAGGCCTG -3'
(R):5'- TGAGTCCTGCCTGTGTAATGAC -3'

Sequencing Primer
(F):5'- TTCCAAAGGCCTGGCAGG -3'
(R):5'- GAGTCCTGCCTGTGTAATGACAAAAC -3'
Posted On 2018-02-28