Incidental Mutation 'R6228:Epg5'
ID504520
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Nameectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
MMRRC Submission 044357-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R6228 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77938467-78035027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 77948462 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 125 (V125F)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044622
AA Change: V125F

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: V125F

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (93/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 G T 7: 46,030,256 T9K probably benign Het
Ankrd28 T C 14: 31,707,220 H925R probably damaging Het
Antxrl A T 14: 34,056,599 T128S probably damaging Het
Atp8b5 T C 4: 43,304,674 Y62H probably damaging Het
AU019823 A G 9: 50,607,671 S214P possibly damaging Het
Bmpr2 G T 1: 59,867,436 V563L probably benign Het
Btn1a1 A T 13: 23,464,351 L104Q probably damaging Het
Caskin1 C G 17: 24,507,180 D1420E probably damaging Het
Cdc14a A T 3: 116,351,213 I150N probably damaging Het
Cdc26 C T 4: 62,402,794 R4Q probably damaging Het
Cfap46 T C 7: 139,656,580 D160G probably damaging Het
Cxcr4 A C 1: 128,592,183 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dgat1 T C 15: 76,503,293 N317S possibly damaging Het
Disp1 G A 1: 183,099,025 T228M possibly damaging Het
Dixdc1 A C 9: 50,703,356 probably null Het
Dnase1l2 C A 17: 24,442,518 probably benign Het
Dsg2 T C 18: 20,594,293 probably null Het
Duox2 A T 2: 122,287,193 F887I probably benign Het
Efcab6 T C 15: 83,967,624 D351G possibly damaging Het
Ep400 A G 5: 110,670,942 V2621A probably damaging Het
Ephb1 T C 9: 101,923,584 R953G probably damaging Het
Etfdh G T 3: 79,612,029 Y272* probably null Het
Fam117b A G 1: 59,969,048 E347G probably damaging Het
Fam214a A G 9: 75,006,363 M100V possibly damaging Het
Gfra3 A T 18: 34,695,793 C183S probably damaging Het
Gm4981 A G 10: 58,235,522 M290T probably benign Het
Gmip A G 8: 69,816,123 D466G probably damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Gpd1 A T 15: 99,723,265 Q320L possibly damaging Het
H2-Oa G T 17: 34,093,877 D43Y probably damaging Het
Hecw1 T A 13: 14,346,038 I205F probably damaging Het
Ighv8-13 A G 12: 115,765,353 Y95H probably damaging Het
Igkv6-20 T C 6: 70,336,097 M31V possibly damaging Het
Itih1 T C 14: 30,931,260 D737G probably benign Het
Kcnc4 G C 3: 107,448,377 H252D probably damaging Het
Kcnj14 T A 7: 45,819,497 T195S probably damaging Het
Limch1 A T 5: 67,016,502 D642V probably damaging Het
Lrp2 T G 2: 69,482,366 D2526A possibly damaging Het
Lrrc8a A G 2: 30,256,553 T460A possibly damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Lypd8 A T 11: 58,386,803 Q137L possibly damaging Het
Mapkapk3 A G 9: 107,260,063 Y206H probably damaging Het
Mrc1 G A 2: 14,271,304 G483D probably benign Het
Mrpl35 C A 6: 71,823,677 probably benign Het
Mycbp2 T A 14: 103,260,229 H936L probably benign Het
Myh3 A T 11: 67,087,486 Y433F probably benign Het
Napb C T 2: 148,698,178 probably null Het
Nbeal1 C A 1: 60,295,924 Q2288K probably benign Het
Ndst3 G A 3: 123,671,652 Q224* probably null Het
Nkd2 A G 13: 73,821,460 S284P probably benign Het
Olfr1100 T C 2: 86,978,691 Y35C probably damaging Het
Olfr1448 A T 19: 12,919,937 V124E probably damaging Het
Olfr420 G A 1: 174,152,146 S210N probably benign Het
Olfr714 T C 7: 107,074,136 Y103H probably damaging Het
Pcdhb8 A G 18: 37,356,984 T572A probably benign Het
Pcdhb9 A G 18: 37,402,062 I370V probably benign Het
Pcsk5 T G 19: 17,581,267 E592A possibly damaging Het
Pigc T C 1: 161,970,467 V6A probably benign Het
Pla2g6 T G 15: 79,305,724 I389L probably benign Het
Pnliprp2 T C 19: 58,763,442 probably null Het
Psmb11 T C 14: 54,626,189 V288A probably benign Het
Rapgef5 A G 12: 117,721,663 probably null Het
Rcn3 T C 7: 45,083,296 N316S probably damaging Het
Rgs6 A G 12: 83,065,964 K183E probably damaging Het
Rhoc A G 3: 104,792,981 probably null Het
Serinc5 T C 13: 92,708,108 C453R probably damaging Het
Slc14a1 A C 18: 78,116,399 M93R probably damaging Het
Slc25a3 A T 10: 91,122,228 D83E probably damaging Het
Slc36a3 T C 11: 55,124,951 Y459C probably benign Het
Slc44a5 A T 3: 154,239,163 Y139F probably benign Het
Spag17 A T 3: 100,022,602 Q539L probably benign Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Stard9 A G 2: 120,713,750 Y4450C probably damaging Het
Taf6l C T 19: 8,778,666 R206Q probably benign Het
Tbc1d23 C T 16: 57,182,903 V501I probably damaging Het
Thap2 T C 10: 115,372,846 H123R probably damaging Het
Tlx3 C A 11: 33,202,432 W221L probably benign Het
Tmem262 T A 19: 6,080,537 probably null Het
Tpmt C A 13: 47,027,259 R201S probably benign Het
Trpm6 T C 19: 18,854,291 S1507P probably damaging Het
Ttc9c T C 19: 8,818,483 E64G possibly damaging Het
Ttn A T 2: 76,810,446 S13653T probably damaging Het
Ugt3a1 G T 15: 9,310,640 W336L possibly damaging Het
Vmn1r215 C A 13: 23,076,463 N224K probably benign Het
Vmn2r59 C T 7: 42,042,411 probably null Het
Wdfy3 A G 5: 101,898,429 S1853P possibly damaging Het
Wdr36 A T 18: 32,842,006 Y137F possibly damaging Het
Zdhhc17 T C 10: 110,956,355 D324G probably benign Het
Zfp217 T C 2: 170,119,577 T277A probably benign Het
Zfp451 A G 1: 33,803,138 probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp871 T C 17: 32,775,884 S106G possibly damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
R7414:Epg5 UTSW 18 77983532 missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78023278 missense probably benign 0.01
R7535:Epg5 UTSW 18 78032926 missense probably benign 0.18
R7586:Epg5 UTSW 18 78030060 missense probably benign
R7651:Epg5 UTSW 18 77981400 nonsense probably null
R7715:Epg5 UTSW 18 77968586 missense probably damaging 1.00
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCAAAGGAGATGACCTGAAGTCG -3'
(R):5'- ACACCTTTGAACAGCCGAGG -3'

Sequencing Primer
(F):5'- ACCTGAAGTCGTCTGCTGAC -3'
(R):5'- AGGGCGGCTTCATCTTGC -3'
Posted On2018-02-28