Incidental Mutation 'R6229:Lmo1'
ID504558
Institutional Source Beutler Lab
Gene Symbol Lmo1
Ensembl Gene ENSMUSG00000036111
Gene NameLIM domain only 1
SynonymsRbtn1, Rbtn-1, Ttg1
MMRRC Submission 044358-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.757) question?
Stock #R6229 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location109138572-109175207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109143625 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 13 (C13R)
Ref Sequence ENSEMBL: ENSMUSP00000146588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036992] [ENSMUST00000207178] [ENSMUST00000208136]
Predicted Effect probably damaging
Transcript: ENSMUST00000036992
AA Change: C24R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037079
Gene: ENSMUSG00000036111
AA Change: C24R

DomainStartEndE-ValueType
LIM 23 77 8.69e-15 SMART
LIM 87 141 4.12e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207178
AA Change: C23R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208136
AA Change: C13R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208480
Meta Mutation Damage Score 0.9695 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a transcriptional regulator that contains two cysteine-rich LIM domains but lacks a DNA-binding domain. LIM domains may play a role in protein interactions; thus the encoded protein may regulate transcription by competitively binding to specific DNA-binding transcription factors. Alterations at this locus have been associated with acute lymphoblastic T-cell leukemia. Chromosomal rearrangements have been observed between this locus and at least two loci, the delta subunit of the T-cell antigen receptor gene and the LIM domain binding 1 gene. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G A 1: 120,171,483 probably null Het
Adamts6 G A 13: 104,347,392 probably null Het
Add3 C A 19: 53,234,846 A343D probably benign Het
Ankub1 T C 3: 57,665,107 D398G probably benign Het
Apbb1 C T 7: 105,573,730 A225T probably damaging Het
Apbb1 C A 7: 105,573,731 W224C probably damaging Het
Arhgef40 A T 14: 51,990,090 Q431L probably benign Het
Calm4 A G 13: 3,838,038 D48G possibly damaging Het
Ccdc18 A T 5: 108,171,618 I502L probably benign Het
Cftr T C 6: 18,220,684 S185P probably damaging Het
Chd2 C A 7: 73,451,723 K1418N possibly damaging Het
Cmya5 A C 13: 93,093,306 V1758G probably benign Het
Cpsf4l T C 11: 113,708,854 K35R possibly damaging Het
Cyp2c68 A T 19: 39,739,178 V119E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah3 G T 7: 119,965,488 Q2651K probably benign Het
Eif4g2 T C 7: 111,077,713 probably null Het
Enc1 A G 13: 97,245,491 R170G probably benign Het
Enpp2 T C 15: 54,877,832 R357G probably damaging Het
Epb41l2 A G 10: 25,499,836 K58E possibly damaging Het
Fis1 A G 5: 136,965,674 probably null Het
Fmo9 A C 1: 166,677,557 M89R possibly damaging Het
Gm13119 T C 4: 144,363,629 M413T probably benign Het
Gm6096 A C 7: 34,251,251 I72L possibly damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Got1l1 T C 8: 27,198,436 probably null Het
Igfbpl1 A G 4: 45,813,517 Y233H probably damaging Het
Il18r1 T C 1: 40,474,763 I43T probably benign Het
Ints8 T C 4: 11,252,891 N64D probably damaging Het
Kalrn A G 16: 34,055,071 S44P probably damaging Het
Kif13b G T 14: 64,738,567 G444W probably damaging Het
Lrfn2 T A 17: 49,097,132 M761K possibly damaging Het
Lrrd1 T C 5: 3,863,887 I719T probably damaging Het
Madd A T 2: 91,143,670 V1423E probably damaging Het
Mbnl1 T A 3: 60,621,328 probably null Het
Mrps28 T C 3: 8,900,037 D114G probably damaging Het
Muc6 T A 7: 141,640,525 M1412L probably benign Het
Myf6 T C 10: 107,494,419 K96E possibly damaging Het
Myrf A G 19: 10,219,798 V462A probably benign Het
Nbeal1 T C 1: 60,248,365 S923P possibly damaging Het
Nckap1l T C 15: 103,473,122 L430P possibly damaging Het
Nfatc2ip C T 7: 126,395,941 probably null Het
Olfr1145 G T 2: 87,810,087 C89F probably damaging Het
Olfr1362 T C 13: 21,611,649 I107V probably benign Het
Olfr739 A G 14: 50,425,205 R229G probably benign Het
Olfr853 T A 9: 19,537,718 I71F possibly damaging Het
Plin2 A G 4: 86,668,666 V5A probably benign Het
Ptprm T A 17: 66,688,300 D1311V probably damaging Het
Recql5 A T 11: 115,930,714 I72N probably damaging Het
Sall2 A T 14: 52,313,191 M847K probably benign Het
Slc23a1 T C 18: 35,619,524 R567G probably benign Het
Slc28a1 G A 7: 81,125,005 R200H probably benign Het
Smc4 T A 3: 69,030,247 Y843* probably null Het
Syne2 C A 12: 75,921,220 Q915K probably benign Het
Tas2r131 T A 6: 132,957,022 I275F probably damaging Het
Tcf20 T C 15: 82,854,880 H790R probably damaging Het
Tm7sf3 A G 6: 146,613,389 F310S possibly damaging Het
Tmem9b T A 7: 109,745,420 probably null Het
Tnfaip8 A G 18: 50,051,675 probably benign Het
Top2b T G 14: 16,409,838 L835R probably damaging Het
Trappc8 A T 18: 20,870,745 S209T probably benign Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Uap1 C T 1: 170,166,733 R58Q probably benign Het
Upk3bl A G 5: 136,064,061 probably null Het
Usp34 A G 11: 23,446,778 H596R probably damaging Het
Vmn1r181 C T 7: 23,984,155 A15V probably damaging Het
Vmn2r54 T A 7: 12,631,956 K350N probably benign Het
Vmn2r89 A G 14: 51,455,721 H176R probably benign Het
Vwa7 A G 17: 35,024,265 R640G probably benign Het
Other mutations in Lmo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Lmo1 APN 7 109143450 splice site probably benign
minikin UTSW 7 109143576 missense probably damaging 1.00
R2507:Lmo1 UTSW 7 109140641 missense probably damaging 1.00
R6518:Lmo1 UTSW 7 109143576 missense probably damaging 1.00
R7312:Lmo1 UTSW 7 109143612 missense probably benign 0.01
R7454:Lmo1 UTSW 7 109140666 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAGTTGCACCAGGCTAGAAG -3'
(R):5'- CTCTGAGAGCCTTTTCTTAGAGG -3'

Sequencing Primer
(F):5'- CTGTTCAAGTAGGGCAGGAC -3'
(R):5'- GAGCCTTTTCTTAGAGGAAACAGTC -3'
Posted On2018-02-28