Incidental Mutation 'R6230:Col27a1'
ID504610
Institutional Source Beutler Lab
Gene Symbol Col27a1
Ensembl Gene ENSMUSG00000045672
Gene Namecollagen, type XXVII, alpha 1
Synonyms
MMRRC Submission 044359-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6230 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location63214004-63334991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63224282 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 69 (I69T)
Ref Sequence ENSEMBL: ENSMUSP00000043816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036300]
Predicted Effect probably damaging
Transcript: ENSMUST00000036300
AA Change: I69T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043816
Gene: ENSMUSG00000045672
AA Change: I69T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
TSPN 43 223 1.1e-5 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 356 372 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 455 467 N/A INTRINSIC
low complexity region 584 597 N/A INTRINSIC
Pfam:Collagen 609 670 2.1e-10 PFAM
Pfam:Collagen 666 731 3.7e-10 PFAM
low complexity region 790 808 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 858 880 N/A INTRINSIC
low complexity region 886 910 N/A INTRINSIC
low complexity region 912 946 N/A INTRINSIC
Pfam:Collagen 1012 1080 2.8e-8 PFAM
Pfam:Collagen 1033 1103 3e-9 PFAM
Pfam:Collagen 1063 1130 3.4e-9 PFAM
low complexity region 1150 1168 N/A INTRINSIC
Pfam:Collagen 1207 1281 5.5e-9 PFAM
Pfam:Collagen 1261 1324 8.4e-10 PFAM
Pfam:Collagen 1323 1384 3.8e-12 PFAM
low complexity region 1438 1466 N/A INTRINSIC
internal_repeat_4 1467 1502 1.5e-7 PROSPERO
internal_repeat_2 1468 1529 1.96e-8 PROSPERO
Pfam:Collagen 1544 1606 2.4e-9 PFAM
COLFI 1644 1845 1.28e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148751
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXVII collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein forms a homotrimeric triple helical procollagen that undergoes proteolytic processing during fibril formation. Transgenic mice lacking a portion of the collagenous domain in the encoded protein exhibit skeletal abnormalities, chondrodysplasia and die at birth because of a lung defect. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an in frame deletion display neonatal lethality, respiratory failure, and severe chondrodysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,182,532 T948A probably benign Het
AI481877 T C 4: 59,099,345 N116D probably benign Het
Arhgef12 T C 9: 42,988,965 I871V probably benign Het
Atf1 T C 15: 100,232,824 V25A possibly damaging Het
Atp23 G A 10: 126,887,562 H224Y probably benign Het
B020004J07Rik T A 4: 101,837,214 E157D probably damaging Het
Ccpg1 A G 9: 73,012,356 T418A probably benign Het
Cspp1 T C 1: 10,077,197 S328P probably benign Het
Cttnbp2nl C T 3: 105,011,339 E62K probably damaging Het
Cyp2c39 T C 19: 39,536,802 F183S probably damaging Het
Dync2li1 T C 17: 84,647,650 S246P probably damaging Het
Ext2 A G 2: 93,762,620 I413T probably damaging Het
Fam174a T C 1: 95,314,226 V137A probably damaging Het
Flg T A 3: 93,279,475 V78E probably damaging Het
Fn3krp C A 11: 121,425,592 H111N probably damaging Het
Focad T C 4: 88,342,204 I899T unknown Het
Foxq1 T C 13: 31,559,508 Y198H probably damaging Het
Gm21060 A T 19: 61,297,011 M20K probably benign Het
Kif16b A T 2: 142,849,912 N217K probably damaging Het
Klkb1 A G 8: 45,283,215 Y162H probably benign Het
Kntc1 T A 5: 123,789,009 probably null Het
Madd C T 2: 91,143,521 probably null Het
Mast2 T A 4: 116,326,098 H258L probably damaging Het
Musk T C 4: 58,367,576 V598A probably damaging Het
Nexn T A 3: 152,238,275 Q539L probably damaging Het
Nf2 T C 11: 4,808,262 K130E possibly damaging Het
Nlrp14 A T 7: 107,181,817 I74F probably benign Het
Olfr689 A G 7: 105,314,082 H26R possibly damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Omg T C 11: 79,502,958 I25V probably benign Het
Parp4 A G 14: 56,607,533 D627G probably damaging Het
Pdia6 A G 12: 17,277,213 E126G probably benign Het
Ppp1r2 T A 16: 31,260,600 D127V possibly damaging Het
Rgs22 A G 15: 36,100,030 S304P probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr2 T C 13: 11,660,107 Y3378C probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smurf2 T C 11: 106,868,504 probably null Het
Tanc1 T C 2: 59,842,031 F1348L probably damaging Het
Tarsl2 A T 7: 65,686,436 probably null Het
Tmem213 A T 6: 38,114,616 S52C probably damaging Het
Ttn T C 2: 76,919,434 D3757G probably benign Het
Usp16 C T 16: 87,464,798 P101S possibly damaging Het
Usp19 G A 9: 108,501,941 M1318I probably damaging Het
Vmn1r75 G A 7: 11,881,039 A233T probably damaging Het
Vsir A T 10: 60,358,078 N107Y probably damaging Het
Zfp160 T C 17: 21,026,445 V419A probably benign Het
Zfp808 A T 13: 62,172,322 H455L probably benign Het
Other mutations in Col27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Col27a1 APN 4 63300741 splice site probably benign
IGL01461:Col27a1 APN 4 63224243 missense probably damaging 1.00
IGL01534:Col27a1 APN 4 63225782 missense probably benign 0.12
IGL01738:Col27a1 APN 4 63263779 splice site probably benign
IGL01810:Col27a1 APN 4 63225631 missense probably benign 0.21
IGL02127:Col27a1 APN 4 63225142 missense possibly damaging 0.60
IGL02290:Col27a1 APN 4 63225926 missense probably damaging 1.00
IGL02374:Col27a1 APN 4 63293249 missense possibly damaging 0.86
IGL02548:Col27a1 APN 4 63318255 splice site probably benign
IGL02792:Col27a1 APN 4 63315583 missense unknown
IGL02931:Col27a1 APN 4 63331426 utr 3 prime probably benign
IGL03107:Col27a1 APN 4 63324632 splice site probably benign
IGL03121:Col27a1 APN 4 63225209 missense probably benign 0.26
IGL03334:Col27a1 APN 4 63314722 missense probably damaging 1.00
R0005:Col27a1 UTSW 4 63225400 missense probably benign 0.04
R0025:Col27a1 UTSW 4 63275977 missense probably damaging 1.00
R0141:Col27a1 UTSW 4 63265633 critical splice acceptor site probably null
R0196:Col27a1 UTSW 4 63224266 missense probably benign 0.02
R0359:Col27a1 UTSW 4 63314727 critical splice donor site probably null
R0375:Col27a1 UTSW 4 63225661 missense probably benign 0.23
R0432:Col27a1 UTSW 4 63225611 missense possibly damaging 0.87
R0499:Col27a1 UTSW 4 63300741 splice site probably benign
R0786:Col27a1 UTSW 4 63291578 critical splice donor site probably null
R0891:Col27a1 UTSW 4 63305183 critical splice acceptor site probably null
R1239:Col27a1 UTSW 4 63318915 splice site probably benign
R1297:Col27a1 UTSW 4 63265631 splice site probably benign
R1299:Col27a1 UTSW 4 63265631 splice site probably benign
R1322:Col27a1 UTSW 4 63328566 utr 3 prime probably benign
R1342:Col27a1 UTSW 4 63257114 critical splice donor site probably null
R1446:Col27a1 UTSW 4 63224803 missense probably damaging 1.00
R1629:Col27a1 UTSW 4 63329863 utr 3 prime probably benign
R1644:Col27a1 UTSW 4 63328631 utr 3 prime probably benign
R1774:Col27a1 UTSW 4 63225713 missense probably damaging 1.00
R1807:Col27a1 UTSW 4 63331349 utr 3 prime probably benign
R1952:Col27a1 UTSW 4 63283893 intron probably null
R1957:Col27a1 UTSW 4 63277794 missense probably benign 0.03
R1970:Col27a1 UTSW 4 63273117 splice site probably benign
R2164:Col27a1 UTSW 4 63225424 missense probably benign 0.21
R3774:Col27a1 UTSW 4 63314726 missense probably benign 0.00
R4078:Col27a1 UTSW 4 63224432 missense probably damaging 1.00
R4353:Col27a1 UTSW 4 63225631 missense probably benign 0.21
R4611:Col27a1 UTSW 4 63293506 missense probably damaging 1.00
R4708:Col27a1 UTSW 4 63283913 missense probably benign 0.01
R4884:Col27a1 UTSW 4 63275960 missense possibly damaging 0.77
R5149:Col27a1 UTSW 4 63331427 utr 3 prime probably benign
R5411:Col27a1 UTSW 4 63224665 missense probably damaging 1.00
R5451:Col27a1 UTSW 4 63225239 missense probably damaging 0.98
R5615:Col27a1 UTSW 4 63281114 missense probably damaging 0.96
R5657:Col27a1 UTSW 4 63225310 missense probably damaging 0.97
R5838:Col27a1 UTSW 4 63225528 missense probably damaging 1.00
R6326:Col27a1 UTSW 4 63324441 utr 3 prime probably benign
R6457:Col27a1 UTSW 4 63319464 utr 3 prime probably benign
R6624:Col27a1 UTSW 4 63225011 missense probably benign 0.00
R6792:Col27a1 UTSW 4 63317503 missense unknown
R6848:Col27a1 UTSW 4 63302371 missense probably benign
R6962:Col27a1 UTSW 4 63319501 utr 3 prime probably benign
R7053:Col27a1 UTSW 4 63333167 utr 3 prime probably benign
R7206:Col27a1 UTSW 4 63235346 missense probably benign 0.29
R7586:Col27a1 UTSW 4 63225041 missense probably damaging 1.00
R7698:Col27a1 UTSW 4 63225718 missense possibly damaging 0.78
R7714:Col27a1 UTSW 4 63324486 critical splice donor site probably null
Z1176:Col27a1 UTSW 4 63225788
Z1177:Col27a1 UTSW 4 63281289
Predicted Primers PCR Primer
(F):5'- AAGGTTGCAGTCTGTCATAGATG -3'
(R):5'- AGACCCAGTTGCAGCTTGTG -3'

Sequencing Primer
(F):5'- ATGGTTGCAATGCGACACCTC -3'
(R):5'- CAGTTGCAGCTTGTGTTTCC -3'
Posted On2018-02-28