Incidental Mutation 'R6230:Ccpg1'
ID504623
Institutional Source Beutler Lab
Gene Symbol Ccpg1
Ensembl Gene ENSMUSG00000034563
Gene Namecell cycle progression 1
Synonyms1700030B06Rik, D9Ertd392e, 1810073J13Rik, 9430028F23Rik
MMRRC Submission 044359-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6230 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location72985429-73016340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73012356 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 418 (T418A)
Ref Sequence ENSEMBL: ENSMUSP00000122966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037977] [ENSMUST00000085350] [ENSMUST00000093819] [ENSMUST00000098566] [ENSMUST00000124008] [ENSMUST00000140675] [ENSMUST00000149692] [ENSMUST00000150826] [ENSMUST00000183746] [ENSMUST00000184035] [ENSMUST00000184389]
Predicted Effect probably benign
Transcript: ENSMUST00000037977
AA Change: T418A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000045669
Gene: ENSMUSG00000034563
AA Change: T418A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085350
AA Change: T418A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000082458
Gene: ENSMUSG00000034563
AA Change: T418A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093819
Predicted Effect probably benign
Transcript: ENSMUST00000098566
SMART Domains Protein: ENSMUSP00000096165
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 4.7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124008
SMART Domains Protein: ENSMUSP00000121059
Gene: ENSMUSG00000034563

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138466
Predicted Effect probably benign
Transcript: ENSMUST00000140675
AA Change: T418A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116976
Gene: ENSMUSG00000034563
AA Change: T418A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149692
SMART Domains Protein: ENSMUSP00000120629
Gene: ENSMUSG00000089865

DomainStartEndE-ValueType
Pfam:CS 6 77 2.1e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
Pfam:TPR_11 286 352 2e-14 PFAM
Pfam:TPR_1 322 352 5.6e-6 PFAM
Blast:TPR 364 386 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150826
AA Change: T418A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000122966
Gene: ENSMUSG00000034563
AA Change: T418A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183746
SMART Domains Protein: ENSMUSP00000138885
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184035
SMART Domains Protein: ENSMUSP00000139269
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184389
SMART Domains Protein: ENSMUSP00000139076
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.1%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,182,532 T948A probably benign Het
AI481877 T C 4: 59,099,345 N116D probably benign Het
Arhgef12 T C 9: 42,988,965 I871V probably benign Het
Atf1 T C 15: 100,232,824 V25A possibly damaging Het
Atp23 G A 10: 126,887,562 H224Y probably benign Het
B020004J07Rik T A 4: 101,837,214 E157D probably damaging Het
Col27a1 T C 4: 63,224,282 I69T probably damaging Het
Cspp1 T C 1: 10,077,197 S328P probably benign Het
Cttnbp2nl C T 3: 105,011,339 E62K probably damaging Het
Cyp2c39 T C 19: 39,536,802 F183S probably damaging Het
Dync2li1 T C 17: 84,647,650 S246P probably damaging Het
Ext2 A G 2: 93,762,620 I413T probably damaging Het
Fam174a T C 1: 95,314,226 V137A probably damaging Het
Flg T A 3: 93,279,475 V78E probably damaging Het
Fn3krp C A 11: 121,425,592 H111N probably damaging Het
Focad T C 4: 88,342,204 I899T unknown Het
Foxq1 T C 13: 31,559,508 Y198H probably damaging Het
Gm21060 A T 19: 61,297,011 M20K probably benign Het
Kif16b A T 2: 142,849,912 N217K probably damaging Het
Klkb1 A G 8: 45,283,215 Y162H probably benign Het
Kntc1 T A 5: 123,789,009 probably null Het
Madd C T 2: 91,143,521 probably null Het
Mast2 T A 4: 116,326,098 H258L probably damaging Het
Musk T C 4: 58,367,576 V598A probably damaging Het
Nexn T A 3: 152,238,275 Q539L probably damaging Het
Nf2 T C 11: 4,808,262 K130E possibly damaging Het
Nlrp14 A T 7: 107,181,817 I74F probably benign Het
Olfr689 A G 7: 105,314,082 H26R possibly damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Omg T C 11: 79,502,958 I25V probably benign Het
Parp4 A G 14: 56,607,533 D627G probably damaging Het
Pdia6 A G 12: 17,277,213 E126G probably benign Het
Ppp1r2 T A 16: 31,260,600 D127V possibly damaging Het
Rgs22 A G 15: 36,100,030 S304P probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr2 T C 13: 11,660,107 Y3378C probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smurf2 T C 11: 106,868,504 probably null Het
Tanc1 T C 2: 59,842,031 F1348L probably damaging Het
Tarsl2 A T 7: 65,686,436 probably null Het
Tmem213 A T 6: 38,114,616 S52C probably damaging Het
Ttn T C 2: 76,919,434 D3757G probably benign Het
Usp16 C T 16: 87,464,798 P101S possibly damaging Het
Usp19 G A 9: 108,501,941 M1318I probably damaging Het
Vmn1r75 G A 7: 11,881,039 A233T probably damaging Het
Vsir A T 10: 60,358,078 N107Y probably damaging Het
Zfp160 T C 17: 21,026,445 V419A probably benign Het
Zfp808 A T 13: 62,172,322 H455L probably benign Het
Other mutations in Ccpg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01665:Ccpg1 APN 9 73005877 missense probably damaging 1.00
IGL01710:Ccpg1 APN 9 72997441 utr 3 prime probably benign
IGL01818:Ccpg1 APN 9 72997453 missense probably damaging 1.00
K7894:Ccpg1 UTSW 9 73001877 critical splice donor site probably null
R0586:Ccpg1 UTSW 9 73001821 missense probably benign 0.00
R1188:Ccpg1 UTSW 9 73012506 missense possibly damaging 0.55
R1503:Ccpg1 UTSW 9 72999478 missense probably benign 0.00
R1599:Ccpg1 UTSW 9 72999125 nonsense probably null
R2130:Ccpg1 UTSW 9 73013158 missense probably damaging 0.98
R2188:Ccpg1 UTSW 9 73013106 missense probably benign 0.00
R3052:Ccpg1 UTSW 9 73005868 missense probably damaging 1.00
R4155:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4156:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4157:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4257:Ccpg1 UTSW 9 73012627 missense probably damaging 1.00
R4677:Ccpg1 UTSW 9 73015915 intron probably benign
R5081:Ccpg1 UTSW 9 72999078 missense possibly damaging 0.94
R5227:Ccpg1 UTSW 9 73012072 nonsense probably null
R5288:Ccpg1 UTSW 9 73013044 missense probably benign
R5385:Ccpg1 UTSW 9 73013044 missense probably benign
R5386:Ccpg1 UTSW 9 73013044 missense probably benign
R5412:Ccpg1 UTSW 9 73010306 missense probably damaging 1.00
R5754:Ccpg1 UTSW 9 73013244 missense possibly damaging 0.78
R7269:Ccpg1 UTSW 9 73013327 missense probably benign 0.06
R7287:Ccpg1 UTSW 9 73015406 missense probably benign 0.05
R7542:Ccpg1 UTSW 9 73012459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGAACCAGGTCCTTAAGC -3'
(R):5'- AGAAATGTCTCCTTCGACTTGC -3'

Sequencing Primer
(F):5'- CCAGGTCCTTAAGCAGTACTTAG -3'
(R):5'- GAAATGTCTCCTTCGACTTGCTCTTC -3'
Posted On2018-02-28