Incidental Mutation 'R6230:Usp19'
ID504624
Institutional Source Beutler Lab
Gene Symbol Usp19
Ensembl Gene ENSMUSG00000006676
Gene Nameubiquitin specific peptidase 19
Synonyms8430421I07Rik
MMRRC Submission 044359-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R6230 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108490602-108502337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108501941 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1318 (M1318I)
Ref Sequence ENSEMBL: ENSMUSP00000141738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]
Predicted Effect probably benign
Transcript: ENSMUST00000006854
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085044
AA Change: M1319I

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676
AA Change: M1319I

DomainStartEndE-ValueType
Pfam:CS 55 129 4.7e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 2.5e-15 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 524 530 N/A INTRINSIC
Pfam:UCH 538 1253 7.4e-84 PFAM
Pfam:UCH_1 539 879 2.3e-13 PFAM
Pfam:zf-MYND 833 875 2.4e-10 PFAM
Pfam:UCH_1 1020 1235 2.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166103
AA Change: M1295I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676
AA Change: M1295I

DomainStartEndE-ValueType
Pfam:CS 55 129 2.6e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 390 3.9e-9 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 500 506 N/A INTRINSIC
Pfam:UCH 514 1229 1.8e-84 PFAM
Pfam:UCH_1 515 855 5.5e-14 PFAM
Pfam:zf-MYND 809 851 1.7e-10 PFAM
Pfam:UCH_1 996 1211 6.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178075
AA Change: M1320I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676
AA Change: M1320I

DomainStartEndE-ValueType
Pfam:CS 55 129 1e-6 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 5.4e-15 PFAM
low complexity region 450 461 N/A INTRINSIC
low complexity region 525 531 N/A INTRINSIC
Pfam:UCH 539 1254 4.9e-84 PFAM
Pfam:UCH_1 540 880 1.4e-13 PFAM
Pfam:zf-MYND 834 876 5.2e-10 PFAM
Pfam:UCH_1 1021 1236 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193571
Predicted Effect probably damaging
Transcript: ENSMUST00000193678
AA Change: M1318I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676
AA Change: M1318I

DomainStartEndE-ValueType
Pfam:CS 55 129 6.8e-7 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 3.6e-15 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 523 529 N/A INTRINSIC
Pfam:UCH 537 1252 3.8e-84 PFAM
Pfam:UCH_1 538 878 1.1e-13 PFAM
Pfam:zf-MYND 832 874 5.1e-10 PFAM
Pfam:UCH_1 1019 1234 1.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193975
Predicted Effect probably benign
Transcript: ENSMUST00000194171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194225
Predicted Effect probably benign
Transcript: ENSMUST00000194863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195763
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.1%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased body weight, reduced male fertility, and increased resistance to skeletal muscle atrophy induced by both glucocorticoids and denervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,182,532 T948A probably benign Het
AI481877 T C 4: 59,099,345 N116D probably benign Het
Arhgef12 T C 9: 42,988,965 I871V probably benign Het
Atf1 T C 15: 100,232,824 V25A possibly damaging Het
Atp23 G A 10: 126,887,562 H224Y probably benign Het
B020004J07Rik T A 4: 101,837,214 E157D probably damaging Het
Ccpg1 A G 9: 73,012,356 T418A probably benign Het
Col27a1 T C 4: 63,224,282 I69T probably damaging Het
Cspp1 T C 1: 10,077,197 S328P probably benign Het
Cttnbp2nl C T 3: 105,011,339 E62K probably damaging Het
Cyp2c39 T C 19: 39,536,802 F183S probably damaging Het
Dync2li1 T C 17: 84,647,650 S246P probably damaging Het
Ext2 A G 2: 93,762,620 I413T probably damaging Het
Fam174a T C 1: 95,314,226 V137A probably damaging Het
Flg T A 3: 93,279,475 V78E probably damaging Het
Fn3krp C A 11: 121,425,592 H111N probably damaging Het
Focad T C 4: 88,342,204 I899T unknown Het
Foxq1 T C 13: 31,559,508 Y198H probably damaging Het
Gm21060 A T 19: 61,297,011 M20K probably benign Het
Kif16b A T 2: 142,849,912 N217K probably damaging Het
Klkb1 A G 8: 45,283,215 Y162H probably benign Het
Kntc1 T A 5: 123,789,009 probably null Het
Madd C T 2: 91,143,521 probably null Het
Mast2 T A 4: 116,326,098 H258L probably damaging Het
Musk T C 4: 58,367,576 V598A probably damaging Het
Nexn T A 3: 152,238,275 Q539L probably damaging Het
Nf2 T C 11: 4,808,262 K130E possibly damaging Het
Nlrp14 A T 7: 107,181,817 I74F probably benign Het
Olfr689 A G 7: 105,314,082 H26R possibly damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Omg T C 11: 79,502,958 I25V probably benign Het
Parp4 A G 14: 56,607,533 D627G probably damaging Het
Pdia6 A G 12: 17,277,213 E126G probably benign Het
Ppp1r2 T A 16: 31,260,600 D127V possibly damaging Het
Rgs22 A G 15: 36,100,030 S304P probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr2 T C 13: 11,660,107 Y3378C probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smurf2 T C 11: 106,868,504 probably null Het
Tanc1 T C 2: 59,842,031 F1348L probably damaging Het
Tarsl2 A T 7: 65,686,436 probably null Het
Tmem213 A T 6: 38,114,616 S52C probably damaging Het
Ttn T C 2: 76,919,434 D3757G probably benign Het
Usp16 C T 16: 87,464,798 P101S possibly damaging Het
Vmn1r75 G A 7: 11,881,039 A233T probably damaging Het
Vsir A T 10: 60,358,078 N107Y probably damaging Het
Zfp160 T C 17: 21,026,445 V419A probably benign Het
Zfp808 A T 13: 62,172,322 H455L probably benign Het
Other mutations in Usp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Usp19 APN 9 108498961 missense possibly damaging 0.79
IGL02345:Usp19 APN 9 108493858 missense probably benign
IGL03026:Usp19 APN 9 108493145 missense probably damaging 1.00
IGL03057:Usp19 APN 9 108499130 missense probably benign 0.01
IGL03073:Usp19 APN 9 108495803 unclassified probably benign
IGL03333:Usp19 APN 9 108494149 missense probably benign 0.05
PIT4504001:Usp19 UTSW 9 108492970 missense probably benign 0.00
PIT4576001:Usp19 UTSW 9 108492732 critical splice donor site probably null
R0053:Usp19 UTSW 9 108497170 splice site probably null
R0053:Usp19 UTSW 9 108497170 splice site probably null
R0138:Usp19 UTSW 9 108501315 missense possibly damaging 0.86
R0281:Usp19 UTSW 9 108498509 missense probably damaging 1.00
R0386:Usp19 UTSW 9 108499711 missense probably damaging 1.00
R0454:Usp19 UTSW 9 108494240 critical splice donor site probably null
R0506:Usp19 UTSW 9 108494487 missense probably damaging 1.00
R0542:Usp19 UTSW 9 108494385 unclassified probably null
R0800:Usp19 UTSW 9 108495154 missense probably damaging 0.97
R0829:Usp19 UTSW 9 108493801 missense probably benign
R1594:Usp19 UTSW 9 108498522 missense probably damaging 1.00
R1917:Usp19 UTSW 9 108499325 nonsense probably null
R3744:Usp19 UTSW 9 108500181 missense probably damaging 1.00
R3964:Usp19 UTSW 9 108498029 missense probably damaging 1.00
R4275:Usp19 UTSW 9 108498694 missense probably damaging 1.00
R4789:Usp19 UTSW 9 108493234 missense possibly damaging 0.75
R5247:Usp19 UTSW 9 108496065 splice site probably null
R5249:Usp19 UTSW 9 108492608 start codon destroyed probably null 0.85
R5400:Usp19 UTSW 9 108500193 missense probably damaging 1.00
R5445:Usp19 UTSW 9 108497920 missense possibly damaging 0.61
R5578:Usp19 UTSW 9 108493440 missense probably benign
R5934:Usp19 UTSW 9 108492567 unclassified probably benign
R6003:Usp19 UTSW 9 108496380 missense probably damaging 1.00
R6217:Usp19 UTSW 9 108500144 missense probably damaging 1.00
R6505:Usp19 UTSW 9 108496883 missense probably damaging 1.00
R6585:Usp19 UTSW 9 108499727 missense probably damaging 0.97
R6865:Usp19 UTSW 9 108498819 nonsense probably null
R6953:Usp19 UTSW 9 108498931 missense possibly damaging 0.90
R7037:Usp19 UTSW 9 108496958 missense possibly damaging 0.52
R7046:Usp19 UTSW 9 108497135 missense possibly damaging 0.48
R7235:Usp19 UTSW 9 108494924 nonsense probably null
R7705:Usp19 UTSW 9 108501913 missense possibly damaging 0.89
RF041:Usp19 UTSW 9 108493988 critical splice acceptor site unknown
Predicted Primers PCR Primer
(F):5'- CTGTCTAAATGCCGCTGCTG -3'
(R):5'- TCACAACTTGCGAGGTTCCC -3'

Sequencing Primer
(F):5'- AAATGCCGCTGCTGTCTGC -3'
(R):5'- GAGGTTCCCACCCTCAAATCATG -3'
Posted On2018-02-28