Incidental Mutation 'R6230:Slitrk5'
ID504637
Institutional Source Beutler Lab
Gene Symbol Slitrk5
Ensembl Gene ENSMUSG00000033214
Gene NameSLIT and NTRK-like family, member 5
Synonyms2610019D03Rik
MMRRC Submission 044359-MU
Accession Numbers

Ncbi RefSeq: NM_198865.1; MGI:2679448

Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R6230 (G1)
Quality Score217.468
Status Validated
Chromosome14
Chromosomal Location111675097-111683141 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GACTAC to GACTACTAC at 111679816 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042767] [ENSMUST00000227891]
Predicted Effect probably benign
Transcript: ENSMUST00000042767
SMART Domains Protein: ENSMUSP00000041499
Gene: ENSMUSG00000033214

DomainStartEndE-ValueType
Blast:LRRNT 47 85 3e-18 BLAST
low complexity region 86 96 N/A INTRINSIC
LRR 108 127 2.76e2 SMART
LRR_TYP 128 151 1.67e-2 SMART
LRR 152 175 2.67e-1 SMART
LRR 176 199 1.08e-1 SMART
LRR 202 223 7.38e1 SMART
LRRCT 235 285 2.13e-5 SMART
low complexity region 308 323 N/A INTRINSIC
LRRNT 373 410 9.53e-2 SMART
LRR 433 455 1.45e1 SMART
LRR_TYP 456 479 4.94e-5 SMART
LRR_TYP 480 503 7.78e-3 SMART
LRR_TYP 504 527 2.43e-4 SMART
LRR 528 551 1.86e2 SMART
LRRCT 563 613 3.59e-3 SMART
low complexity region 618 632 N/A INTRINSIC
transmembrane domain 666 688 N/A INTRINSIC
low complexity region 794 816 N/A INTRINSIC
low complexity region 818 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227891
Meta Mutation Damage Score 0.1204 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.1%
Validation Efficiency 100% (49/49)
MGI Phenotype Strain: 4459459
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SLITRK family, such as SLITRK5, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1; MIM 603742). Most SLITRKs, including SLITRK5, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity (Aruga et al., 2003 [PubMed 14557068]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal medium spiny neuron morphology and exhibit behavioral abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,182,532 T948A probably benign Het
AI481877 T C 4: 59,099,345 N116D probably benign Het
Arhgef12 T C 9: 42,988,965 I871V probably benign Het
Atf1 T C 15: 100,232,824 V25A possibly damaging Het
Atp23 G A 10: 126,887,562 H224Y probably benign Het
B020004J07Rik T A 4: 101,837,214 E157D probably damaging Het
Ccpg1 A G 9: 73,012,356 T418A probably benign Het
Col27a1 T C 4: 63,224,282 I69T probably damaging Het
Cspp1 T C 1: 10,077,197 S328P probably benign Het
Cttnbp2nl C T 3: 105,011,339 E62K probably damaging Het
Cyp2c39 T C 19: 39,536,802 F183S probably damaging Het
Dync2li1 T C 17: 84,647,650 S246P probably damaging Het
Ext2 A G 2: 93,762,620 I413T probably damaging Het
Fam174a T C 1: 95,314,226 V137A probably damaging Het
Flg T A 3: 93,279,475 V78E probably damaging Het
Fn3krp C A 11: 121,425,592 H111N probably damaging Het
Focad T C 4: 88,342,204 I899T unknown Het
Foxq1 T C 13: 31,559,508 Y198H probably damaging Het
Gm21060 A T 19: 61,297,011 M20K probably benign Het
Kif16b A T 2: 142,849,912 N217K probably damaging Het
Klkb1 A G 8: 45,283,215 Y162H probably benign Het
Kntc1 T A 5: 123,789,009 probably null Het
Madd C T 2: 91,143,521 probably null Het
Mast2 T A 4: 116,326,098 H258L probably damaging Het
Musk T C 4: 58,367,576 V598A probably damaging Het
Nexn T A 3: 152,238,275 Q539L probably damaging Het
Nf2 T C 11: 4,808,262 K130E possibly damaging Het
Nlrp14 A T 7: 107,181,817 I74F probably benign Het
Olfr689 A G 7: 105,314,082 H26R possibly damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Omg T C 11: 79,502,958 I25V probably benign Het
Parp4 A G 14: 56,607,533 D627G probably damaging Het
Pdia6 A G 12: 17,277,213 E126G probably benign Het
Ppp1r2 T A 16: 31,260,600 D127V possibly damaging Het
Rgs22 A G 15: 36,100,030 S304P probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr2 T C 13: 11,660,107 Y3378C probably damaging Het
Smurf2 T C 11: 106,868,504 probably null Het
Tanc1 T C 2: 59,842,031 F1348L probably damaging Het
Tarsl2 A T 7: 65,686,436 probably null Het
Tmem213 A T 6: 38,114,616 S52C probably damaging Het
Ttn T C 2: 76,919,434 D3757G probably benign Het
Usp16 C T 16: 87,464,798 P101S possibly damaging Het
Usp19 G A 9: 108,501,941 M1318I probably damaging Het
Vmn1r75 G A 7: 11,881,039 A233T probably damaging Het
Vsir A T 10: 60,358,078 N107Y probably damaging Het
Zfp160 T C 17: 21,026,445 V419A probably benign Het
Zfp808 A T 13: 62,172,322 H455L probably benign Het
Other mutations in Slitrk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Slitrk5 APN 14 111680665 missense probably benign 0.05
IGL01624:Slitrk5 APN 14 111681094 missense probably damaging 1.00
IGL01680:Slitrk5 APN 14 111679000 missense probably benign 0.23
IGL03234:Slitrk5 APN 14 111679285 missense probably benign 0.00
P0019:Slitrk5 UTSW 14 111680594 missense possibly damaging 0.88
R0323:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R0334:Slitrk5 UTSW 14 111680824 missense probably benign
R0392:Slitrk5 UTSW 14 111679033 missense probably benign 0.06
R0659:Slitrk5 UTSW 14 111680689 missense probably benign 0.00
R1344:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R1754:Slitrk5 UTSW 14 111680519 missense probably damaging 1.00
R1983:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R2070:Slitrk5 UTSW 14 111680189 missense probably damaging 0.99
R2071:Slitrk5 UTSW 14 111680189 missense probably damaging 0.99
R3001:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3002:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3003:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3885:Slitrk5 UTSW 14 111679797 nonsense probably null
R3886:Slitrk5 UTSW 14 111679797 nonsense probably null
R3888:Slitrk5 UTSW 14 111679797 nonsense probably null
R4962:Slitrk5 UTSW 14 111681247 missense probably benign 0.02
R4999:Slitrk5 UTSW 14 111680216 missense probably damaging 0.99
R5036:Slitrk5 UTSW 14 111680884 missense possibly damaging 0.87
R5190:Slitrk5 UTSW 14 111679420 missense probably damaging 1.00
R5237:Slitrk5 UTSW 14 111681686 missense possibly damaging 0.94
R5669:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R5793:Slitrk5 UTSW 14 111679913 missense probably damaging 1.00
R5839:Slitrk5 UTSW 14 111679598 missense probably benign 0.00
R6083:Slitrk5 UTSW 14 111681725 missense probably benign 0.01
R6224:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6225:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6337:Slitrk5 UTSW 14 111680252 missense probably damaging 0.96
R6666:Slitrk5 UTSW 14 111680102 missense probably damaging 0.96
R6818:Slitrk5 UTSW 14 111680294 missense probably benign 0.32
R6895:Slitrk5 UTSW 14 111681653 missense probably damaging 1.00
R7094:Slitrk5 UTSW 14 111680836 missense probably benign 0.02
R7385:Slitrk5 UTSW 14 111680699 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TTACAGCTGGAGGAAAACCC -3'
(R):5'- GCTATGCTGGGGCCATAGTTAC -3'

Sequencing Primer
(F):5'- GAGGAAAACCCCTGGAATTGCTC -3'
(R):5'- GGCCATAGTTACTGTAGCCCAAGTC -3'
Posted On2018-02-28