Incidental Mutation 'R6230:Ppp1r2'
ID504640
Institutional Source Beutler Lab
Gene Symbol Ppp1r2
Ensembl Gene ENSMUSG00000047714
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 2
Synonyms
MMRRC Submission 044359-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6230 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location31251537-31275277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31260600 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 127 (D127V)
Ref Sequence ENSEMBL: ENSMUSP00000060118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060188] [ENSMUST00000115233]
PDB Structure
rat PP1cgamma complexed with mouse inhibitor-2 [X-RAY DIFFRACTION]
Rat pp1c gamma complexed with mouse inhibitor-2 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060188
AA Change: D127V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060118
Gene: ENSMUSG00000047714
AA Change: D127V

DomainStartEndE-ValueType
Pfam:IPP-2 46 174 6.6e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115233
AA Change: D127V

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110888
Gene: ENSMUSG00000047714
AA Change: D127V

DomainStartEndE-ValueType
Pfam:IPP-2 43 175 1.4e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183720
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase-1 (PP1) is one of the main eukaryotic serine/threonine phosphatases. The protein encoded by this gene binds to the catalytic subunit of PP1, strongly inhibiting its activity. Ten related pseudogenes have been found throughout the human genome. Several splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice die during organogenesis. Heterozygous null mice display responses in behavioral assays suggesting enhanced memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,182,532 T948A probably benign Het
AI481877 T C 4: 59,099,345 N116D probably benign Het
Arhgef12 T C 9: 42,988,965 I871V probably benign Het
Atf1 T C 15: 100,232,824 V25A possibly damaging Het
Atp23 G A 10: 126,887,562 H224Y probably benign Het
B020004J07Rik T A 4: 101,837,214 E157D probably damaging Het
Ccpg1 A G 9: 73,012,356 T418A probably benign Het
Col27a1 T C 4: 63,224,282 I69T probably damaging Het
Cspp1 T C 1: 10,077,197 S328P probably benign Het
Cttnbp2nl C T 3: 105,011,339 E62K probably damaging Het
Cyp2c39 T C 19: 39,536,802 F183S probably damaging Het
Dync2li1 T C 17: 84,647,650 S246P probably damaging Het
Ext2 A G 2: 93,762,620 I413T probably damaging Het
Fam174a T C 1: 95,314,226 V137A probably damaging Het
Flg T A 3: 93,279,475 V78E probably damaging Het
Fn3krp C A 11: 121,425,592 H111N probably damaging Het
Focad T C 4: 88,342,204 I899T unknown Het
Foxq1 T C 13: 31,559,508 Y198H probably damaging Het
Gm21060 A T 19: 61,297,011 M20K probably benign Het
Kif16b A T 2: 142,849,912 N217K probably damaging Het
Klkb1 A G 8: 45,283,215 Y162H probably benign Het
Kntc1 T A 5: 123,789,009 probably null Het
Madd C T 2: 91,143,521 probably null Het
Mast2 T A 4: 116,326,098 H258L probably damaging Het
Musk T C 4: 58,367,576 V598A probably damaging Het
Nexn T A 3: 152,238,275 Q539L probably damaging Het
Nf2 T C 11: 4,808,262 K130E possibly damaging Het
Nlrp14 A T 7: 107,181,817 I74F probably benign Het
Olfr689 A G 7: 105,314,082 H26R possibly damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Omg T C 11: 79,502,958 I25V probably benign Het
Parp4 A G 14: 56,607,533 D627G probably damaging Het
Pdia6 A G 12: 17,277,213 E126G probably benign Het
Rgs22 A G 15: 36,100,030 S304P probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr2 T C 13: 11,660,107 Y3378C probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smurf2 T C 11: 106,868,504 probably null Het
Tanc1 T C 2: 59,842,031 F1348L probably damaging Het
Tarsl2 A T 7: 65,686,436 probably null Het
Tmem213 A T 6: 38,114,616 S52C probably damaging Het
Ttn T C 2: 76,919,434 D3757G probably benign Het
Usp16 C T 16: 87,464,798 P101S possibly damaging Het
Usp19 G A 9: 108,501,941 M1318I probably damaging Het
Vmn1r75 G A 7: 11,881,039 A233T probably damaging Het
Vsir A T 10: 60,358,078 N107Y probably damaging Het
Zfp160 T C 17: 21,026,445 V419A probably benign Het
Zfp808 A T 13: 62,172,322 H455L probably benign Het
Other mutations in Ppp1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4531001:Ppp1r2 UTSW 16 31258461 missense probably damaging 1.00
R2321:Ppp1r2 UTSW 16 31265303 critical splice donor site probably null
R4573:Ppp1r2 UTSW 16 31260637 missense possibly damaging 0.85
R7113:Ppp1r2 UTSW 16 31254718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCTTCAAATCAGGAAGGAAACAC -3'
(R):5'- GATGGATTTCTCGCACCCAC -3'

Sequencing Primer
(F):5'- TCAAATCAGGAAGGAAACACTATTAC -3'
(R):5'- GCACCCACTCTGCTATCCTTG -3'
Posted On2018-02-28