Incidental Mutation 'R6230:Usp16'
ID504641
Institutional Source Beutler Lab
Gene Symbol Usp16
Ensembl Gene ENSMUSG00000025616
Gene Nameubiquitin specific peptidase 16
Synonyms2810483I07Rik, 1200004E02Rik, UBP-M, 6330514E22Rik
MMRRC Submission 044359-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6230 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location87454703-87483517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87464798 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 101 (P101S)
Ref Sequence ENSEMBL: ENSMUSP00000114058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000131356] [ENSMUST00000144759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026710
AA Change: P101S

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616
AA Change: P101S

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2.5e-23 PFAM
coiled coil region 149 182 N/A INTRINSIC
Pfam:UCH 194 821 2e-54 PFAM
Pfam:UCH_1 195 800 3.8e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119504
AA Change: P101S

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616
AA Change: P101S

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 6.9e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 732 1.2e-36 PFAM
Pfam:UCH_1 194 737 2.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131206
Predicted Effect probably benign
Transcript: ENSMUST00000131356
Predicted Effect probably benign
Transcript: ENSMUST00000144759
AA Change: P101S

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616
AA Change: P101S

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 330 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177538
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,182,532 T948A probably benign Het
AI481877 T C 4: 59,099,345 N116D probably benign Het
Arhgef12 T C 9: 42,988,965 I871V probably benign Het
Atf1 T C 15: 100,232,824 V25A possibly damaging Het
Atp23 G A 10: 126,887,562 H224Y probably benign Het
B020004J07Rik T A 4: 101,837,214 E157D probably damaging Het
Ccpg1 A G 9: 73,012,356 T418A probably benign Het
Col27a1 T C 4: 63,224,282 I69T probably damaging Het
Cspp1 T C 1: 10,077,197 S328P probably benign Het
Cttnbp2nl C T 3: 105,011,339 E62K probably damaging Het
Cyp2c39 T C 19: 39,536,802 F183S probably damaging Het
Dync2li1 T C 17: 84,647,650 S246P probably damaging Het
Ext2 A G 2: 93,762,620 I413T probably damaging Het
Fam174a T C 1: 95,314,226 V137A probably damaging Het
Flg T A 3: 93,279,475 V78E probably damaging Het
Fn3krp C A 11: 121,425,592 H111N probably damaging Het
Focad T C 4: 88,342,204 I899T unknown Het
Foxq1 T C 13: 31,559,508 Y198H probably damaging Het
Gm21060 A T 19: 61,297,011 M20K probably benign Het
Kif16b A T 2: 142,849,912 N217K probably damaging Het
Klkb1 A G 8: 45,283,215 Y162H probably benign Het
Kntc1 T A 5: 123,789,009 probably null Het
Madd C T 2: 91,143,521 probably null Het
Mast2 T A 4: 116,326,098 H258L probably damaging Het
Musk T C 4: 58,367,576 V598A probably damaging Het
Nexn T A 3: 152,238,275 Q539L probably damaging Het
Nf2 T C 11: 4,808,262 K130E possibly damaging Het
Nlrp14 A T 7: 107,181,817 I74F probably benign Het
Olfr689 A G 7: 105,314,082 H26R possibly damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Omg T C 11: 79,502,958 I25V probably benign Het
Parp4 A G 14: 56,607,533 D627G probably damaging Het
Pdia6 A G 12: 17,277,213 E126G probably benign Het
Ppp1r2 T A 16: 31,260,600 D127V possibly damaging Het
Rgs22 A G 15: 36,100,030 S304P probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr2 T C 13: 11,660,107 Y3378C probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smurf2 T C 11: 106,868,504 probably null Het
Tanc1 T C 2: 59,842,031 F1348L probably damaging Het
Tarsl2 A T 7: 65,686,436 probably null Het
Tmem213 A T 6: 38,114,616 S52C probably damaging Het
Ttn T C 2: 76,919,434 D3757G probably benign Het
Usp19 G A 9: 108,501,941 M1318I probably damaging Het
Vmn1r75 G A 7: 11,881,039 A233T probably damaging Het
Vsir A T 10: 60,358,078 N107Y probably damaging Het
Zfp160 T C 17: 21,026,445 V419A probably benign Het
Zfp808 A T 13: 62,172,322 H455L probably benign Het
Other mutations in Usp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Usp16 APN 16 87466276 missense possibly damaging 0.95
IGL01589:Usp16 APN 16 87479183 missense probably benign 0.00
IGL02570:Usp16 APN 16 87480893 missense probably damaging 1.00
IGL02736:Usp16 APN 16 87464835 missense possibly damaging 0.75
IGL02973:Usp16 APN 16 87479739 missense probably damaging 1.00
IGL03066:Usp16 APN 16 87471833 missense probably damaging 1.00
PIT1430001:Usp16 UTSW 16 87473132 missense probably damaging 0.99
R0395:Usp16 UTSW 16 87475446 missense probably damaging 1.00
R0619:Usp16 UTSW 16 87472164 missense probably benign 0.02
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1549:Usp16 UTSW 16 87464834 missense probably damaging 1.00
R1557:Usp16 UTSW 16 87462142 critical splice donor site probably null
R1776:Usp16 UTSW 16 87479316 missense probably damaging 0.97
R1818:Usp16 UTSW 16 87479132 nonsense probably null
R1835:Usp16 UTSW 16 87480907 missense probably damaging 1.00
R2022:Usp16 UTSW 16 87473126 missense probably damaging 1.00
R2146:Usp16 UTSW 16 87473187 critical splice donor site probably null
R2432:Usp16 UTSW 16 87466358 critical splice donor site probably null
R3110:Usp16 UTSW 16 87471848 splice site probably null
R3112:Usp16 UTSW 16 87471848 splice site probably null
R3771:Usp16 UTSW 16 87458683 start codon destroyed probably null 1.00
R4353:Usp16 UTSW 16 87470354 missense probably damaging 1.00
R4959:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R4973:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R5276:Usp16 UTSW 16 87470451 critical splice donor site probably null
R5753:Usp16 UTSW 16 87482899 missense probably damaging 0.98
R6267:Usp16 UTSW 16 87483191 missense probably benign 0.00
R6473:Usp16 UTSW 16 87483135 missense probably benign 0.00
R6736:Usp16 UTSW 16 87470397 missense probably damaging 1.00
R7006:Usp16 UTSW 16 87471836 missense probably damaging 1.00
R7012:Usp16 UTSW 16 87458744 critical splice donor site probably null
R7040:Usp16 UTSW 16 87480929 missense probably damaging 1.00
R7136:Usp16 UTSW 16 87483171 missense probably benign
R7295:Usp16 UTSW 16 87472089 missense probably benign 0.44
R7434:Usp16 UTSW 16 87479319 nonsense probably null
R7497:Usp16 UTSW 16 87466286 nonsense probably null
R7571:Usp16 UTSW 16 87464835 missense possibly damaging 0.75
R7576:Usp16 UTSW 16 87479300 missense probably benign 0.34
R7624:Usp16 UTSW 16 87476805 missense probably benign 0.23
R7889:Usp16 UTSW 16 87474584 missense probably benign 0.44
R7972:Usp16 UTSW 16 87474584 missense probably benign 0.44
X0061:Usp16 UTSW 16 87479457 missense probably benign 0.01
X0064:Usp16 UTSW 16 87471725 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATCATGCCCAGATGTGCCAC -3'
(R):5'- ATTTTCCCACGCAGCACTAC -3'

Sequencing Primer
(F):5'- TAAATTCCCTGGAGCGCTAG -3'
(R):5'- TCCCACGCAGCACTACATGAC -3'
Posted On2018-02-28