Incidental Mutation 'R6230:Dync2li1'
ID 504643
Institutional Source Beutler Lab
Gene Symbol Dync2li1
Ensembl Gene ENSMUSG00000024253
Gene Name dynein cytoplasmic 2 light intermediate chain 1
Synonyms 4933404O11Rik, mD2LIC, LIC3, CGI-60, D2lic
MMRRC Submission 044359-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6230 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 84933924-84963016 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84955078 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 246 (S246P)
Ref Sequence ENSEMBL: ENSMUSP00000025101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025101]
AlphaFold Q8K0T2
Predicted Effect probably damaging
Transcript: ENSMUST00000025101
AA Change: S246P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025101
Gene: ENSMUSG00000024253
AA Change: S246P

DomainStartEndE-ValueType
Pfam:DLIC 2 179 3.3e-8 PFAM
Meta Mutation Damage Score 0.1745 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the dynein-2 microtubule motor protein complex that plays a role in the retrograde transport of cargo in primary cilia via the intraflagellar transport system. This gene is ubiquitously expressed and its protein, which localizes to the axoneme and Golgi apparatus, interacts directly with the cytoplasmic dynein 2 heavy chain 1 protein to form part of the multi-protein dynein-2 complex. Mutations in this gene produce defects in the dynein-2 complex which result in several types of ciliopathy including short-rib thoracic dysplasia 15 with polydactyly (SRTD15). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for disruptions in this allele die before embryonic day 11.5. They display neural tube defects in addition to a variety developmental patterning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,024,452 (GRCm39) T948A probably benign Het
Arhgef12 T C 9: 42,900,261 (GRCm39) I871V probably benign Het
Atf1 T C 15: 100,130,705 (GRCm39) V25A possibly damaging Het
Atp23 G A 10: 126,723,431 (GRCm39) H224Y probably benign Het
Ccpg1 A G 9: 72,919,638 (GRCm39) T418A probably benign Het
Col27a1 T C 4: 63,142,519 (GRCm39) I69T probably damaging Het
Cspp1 T C 1: 10,147,422 (GRCm39) S328P probably benign Het
Cttnbp2nl C T 3: 104,918,655 (GRCm39) E62K probably damaging Het
Cyp2c39 T C 19: 39,525,246 (GRCm39) F183S probably damaging Het
Ext2 A G 2: 93,592,965 (GRCm39) I413T probably damaging Het
Fam174a T C 1: 95,241,951 (GRCm39) V137A probably damaging Het
Flg T A 3: 93,186,782 (GRCm39) V78E probably damaging Het
Fn3krp C A 11: 121,316,418 (GRCm39) H111N probably damaging Het
Focad T C 4: 88,260,441 (GRCm39) I899T unknown Het
Foxq1 T C 13: 31,743,491 (GRCm39) Y198H probably damaging Het
Gm21060 A T 19: 61,285,449 (GRCm39) M20K probably benign Het
Kif16b A T 2: 142,691,832 (GRCm39) N217K probably damaging Het
Klkb1 A G 8: 45,736,252 (GRCm39) Y162H probably benign Het
Kntc1 T A 5: 123,927,072 (GRCm39) probably null Het
Madd C T 2: 90,973,866 (GRCm39) probably null Het
Mast2 T A 4: 116,183,295 (GRCm39) H258L probably damaging Het
Musk T C 4: 58,367,576 (GRCm39) V598A probably damaging Het
Nexn T A 3: 151,943,912 (GRCm39) Q539L probably damaging Het
Nf2 T C 11: 4,758,262 (GRCm39) K130E possibly damaging Het
Nlrp14 A T 7: 106,781,024 (GRCm39) I74F probably benign Het
Omg T C 11: 79,393,784 (GRCm39) I25V probably benign Het
Or56b35 A G 7: 104,963,289 (GRCm39) H26R possibly damaging Het
Or8b54 T G 9: 38,687,073 (GRCm39) I174S possibly damaging Het
Parp4 A G 14: 56,844,990 (GRCm39) D627G probably damaging Het
Pdia6 A G 12: 17,327,214 (GRCm39) E126G probably benign Het
Ppp1r2 T A 16: 31,079,418 (GRCm39) D127V possibly damaging Het
Pramel17 T A 4: 101,694,411 (GRCm39) E157D probably damaging Het
Rgs22 A G 15: 36,100,176 (GRCm39) S304P probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rptn C G 3: 93,305,437 (GRCm39) H923Q possibly damaging Het
Ryr2 T C 13: 11,674,993 (GRCm39) Y3378C probably damaging Het
Shoc1 T C 4: 59,099,345 (GRCm39) N116D probably benign Het
Slitrk5 GACTAC GACTACTAC 14: 111,917,248 (GRCm39) probably benign Het
Smurf2 T C 11: 106,759,330 (GRCm39) probably null Het
Tanc1 T C 2: 59,672,375 (GRCm39) F1348L probably damaging Het
Tars3 A T 7: 65,336,184 (GRCm39) probably null Het
Tmem213 A T 6: 38,091,551 (GRCm39) S52C probably damaging Het
Ttn T C 2: 76,749,778 (GRCm39) D3757G probably benign Het
Usp16 C T 16: 87,261,686 (GRCm39) P101S possibly damaging Het
Usp19 G A 9: 108,379,140 (GRCm39) M1318I probably damaging Het
Vmn1r75 G A 7: 11,614,966 (GRCm39) A233T probably damaging Het
Vsir A T 10: 60,193,857 (GRCm39) N107Y probably damaging Het
Zfp160 T C 17: 21,246,707 (GRCm39) V419A probably benign Het
Zfp808 A T 13: 62,320,136 (GRCm39) H455L probably benign Het
Other mutations in Dync2li1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dync2li1 APN 17 84,952,154 (GRCm39) missense possibly damaging 0.86
IGL00661:Dync2li1 APN 17 84,956,668 (GRCm39) missense possibly damaging 0.88
IGL01450:Dync2li1 APN 17 84,940,984 (GRCm39) missense possibly damaging 0.53
IGL01610:Dync2li1 APN 17 84,935,742 (GRCm39) missense probably damaging 1.00
R0387:Dync2li1 UTSW 17 84,962,768 (GRCm39) missense possibly damaging 0.69
R0883:Dync2li1 UTSW 17 84,956,699 (GRCm39) missense probably benign 0.01
R1499:Dync2li1 UTSW 17 84,954,667 (GRCm39) splice site probably benign
R1823:Dync2li1 UTSW 17 84,957,225 (GRCm39) missense probably damaging 0.98
R2164:Dync2li1 UTSW 17 84,943,702 (GRCm39) missense probably damaging 1.00
R2394:Dync2li1 UTSW 17 84,952,175 (GRCm39) missense possibly damaging 0.94
R2443:Dync2li1 UTSW 17 84,955,093 (GRCm39) missense probably benign 0.30
R3901:Dync2li1 UTSW 17 84,939,070 (GRCm39) missense probably damaging 1.00
R4151:Dync2li1 UTSW 17 84,935,763 (GRCm39) missense probably benign 0.00
R4934:Dync2li1 UTSW 17 84,956,683 (GRCm39) missense probably benign
R4960:Dync2li1 UTSW 17 84,940,969 (GRCm39) missense probably benign 0.07
R5340:Dync2li1 UTSW 17 84,957,130 (GRCm39) splice site probably null
R5841:Dync2li1 UTSW 17 84,940,990 (GRCm39) missense probably damaging 1.00
R7331:Dync2li1 UTSW 17 84,955,086 (GRCm39) nonsense probably null
R7447:Dync2li1 UTSW 17 84,955,141 (GRCm39) missense possibly damaging 0.77
R8492:Dync2li1 UTSW 17 84,957,134 (GRCm39) splice site probably null
R8827:Dync2li1 UTSW 17 84,955,079 (GRCm39) missense possibly damaging 0.83
R9228:Dync2li1 UTSW 17 84,957,137 (GRCm39) missense probably benign 0.00
R9231:Dync2li1 UTSW 17 84,935,819 (GRCm39) missense probably null 0.19
Predicted Primers PCR Primer
(F):5'- TCATGGTTTGAGCTGACTATGG -3'
(R):5'- TGGGAGCTTCCTCAATTCTGG -3'

Sequencing Primer
(F):5'- GACTATGGTGTTAGTCTGTCACAACC -3'
(R):5'- CAATTCTGGGGATACAAATGAATGC -3'
Posted On 2018-02-28