Incidental Mutation 'R6230:Gm21060'
ID504645
Institutional Source Beutler Lab
Gene Symbol Gm21060
Ensembl Gene ENSMUSG00000095993
Gene Namepredicted gene, 21060
Synonyms
MMRRC Submission 044359-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6230 (G1)
Quality Score207.009
Status Validated
Chromosome19
Chromosomal Location61296902-61297069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61297011 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 20 (M20K)
Ref Sequence ENSEMBL: ENSMUSP00000136027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179346]
Predicted Effect probably benign
Transcript: ENSMUST00000179346
AA Change: M20K

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000136027
Gene: ENSMUSG00000095993
AA Change: M20K

DomainStartEndE-ValueType
ZnF_C2H2 3 25 4.47e-3 SMART
ZnF_C2H2 31 53 1.12e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.1%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp T C 2: 168,182,532 T948A probably benign Het
AI481877 T C 4: 59,099,345 N116D probably benign Het
Arhgef12 T C 9: 42,988,965 I871V probably benign Het
Atf1 T C 15: 100,232,824 V25A possibly damaging Het
Atp23 G A 10: 126,887,562 H224Y probably benign Het
B020004J07Rik T A 4: 101,837,214 E157D probably damaging Het
Ccpg1 A G 9: 73,012,356 T418A probably benign Het
Col27a1 T C 4: 63,224,282 I69T probably damaging Het
Cspp1 T C 1: 10,077,197 S328P probably benign Het
Cttnbp2nl C T 3: 105,011,339 E62K probably damaging Het
Cyp2c39 T C 19: 39,536,802 F183S probably damaging Het
Dync2li1 T C 17: 84,647,650 S246P probably damaging Het
Ext2 A G 2: 93,762,620 I413T probably damaging Het
Fam174a T C 1: 95,314,226 V137A probably damaging Het
Flg T A 3: 93,279,475 V78E probably damaging Het
Fn3krp C A 11: 121,425,592 H111N probably damaging Het
Focad T C 4: 88,342,204 I899T unknown Het
Foxq1 T C 13: 31,559,508 Y198H probably damaging Het
Kif16b A T 2: 142,849,912 N217K probably damaging Het
Klkb1 A G 8: 45,283,215 Y162H probably benign Het
Kntc1 T A 5: 123,789,009 probably null Het
Madd C T 2: 91,143,521 probably null Het
Mast2 T A 4: 116,326,098 H258L probably damaging Het
Musk T C 4: 58,367,576 V598A probably damaging Het
Nexn T A 3: 152,238,275 Q539L probably damaging Het
Nf2 T C 11: 4,808,262 K130E possibly damaging Het
Nlrp14 A T 7: 107,181,817 I74F probably benign Het
Olfr689 A G 7: 105,314,082 H26R possibly damaging Het
Olfr921 T G 9: 38,775,777 I174S possibly damaging Het
Omg T C 11: 79,502,958 I25V probably benign Het
Parp4 A G 14: 56,607,533 D627G probably damaging Het
Pdia6 A G 12: 17,277,213 E126G probably benign Het
Ppp1r2 T A 16: 31,260,600 D127V possibly damaging Het
Rgs22 A G 15: 36,100,030 S304P probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Ryr2 T C 13: 11,660,107 Y3378C probably damaging Het
Slitrk5 GACTAC GACTACTAC 14: 111,679,816 probably benign Het
Smurf2 T C 11: 106,868,504 probably null Het
Tanc1 T C 2: 59,842,031 F1348L probably damaging Het
Tarsl2 A T 7: 65,686,436 probably null Het
Tmem213 A T 6: 38,114,616 S52C probably damaging Het
Ttn T C 2: 76,919,434 D3757G probably benign Het
Usp16 C T 16: 87,464,798 P101S possibly damaging Het
Usp19 G A 9: 108,501,941 M1318I probably damaging Het
Vmn1r75 G A 7: 11,881,039 A233T probably damaging Het
Vsir A T 10: 60,358,078 N107Y probably damaging Het
Zfp160 T C 17: 21,026,445 V419A probably benign Het
Zfp808 A T 13: 62,172,322 H455L probably benign Het
Other mutations in Gm21060
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1961:Gm21060 UTSW 19 61297007 missense possibly damaging 0.71
R6030:Gm21060 UTSW 19 61296973 missense possibly damaging 0.86
R6030:Gm21060 UTSW 19 61296973 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCTTTGAAGGTGACCTTGACAG -3'
(R):5'- CTTTGCAGGCATGAAAGAAGTCG -3'

Sequencing Primer
(F):5'- TGACCTTGACAGACAAAGAATTTACC -3'
(R):5'- GCATGTCACAGTTATCCTCCAAGG -3'
Posted On2018-02-28