Incidental Mutation 'R6232:Pkp1'
ID504650
Institutional Source Beutler Lab
Gene Symbol Pkp1
Ensembl Gene ENSMUSG00000026413
Gene Nameplakophilin 1
Synonyms
MMRRC Submission 044360-MU
Accession Numbers

NCBI RefSeq: NM_019645.2; MGI: 1328359

Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R6232 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location135871395-135919207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135886861 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 241 (I241F)
Ref Sequence ENSEMBL: ENSMUSP00000128418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027667] [ENSMUST00000163260] [ENSMUST00000189805]
Predicted Effect probably benign
Transcript: ENSMUST00000027667
AA Change: I241F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000027667
Gene: ENSMUSG00000026413
AA Change: I241F

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163260
AA Change: I241F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000128418
Gene: ENSMUSG00000026413
AA Change: I241F

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
ARM 277 317 2.65e-9 SMART
ARM 319 360 3.47e-4 SMART
ARM 361 416 1.3e1 SMART
ARM 417 464 5.59e1 SMART
ARM 516 557 8.48e1 SMART
ARM 565 604 3.85e0 SMART
ARM 605 650 5.76e1 SMART
Predicted Effect silent
Transcript: ENSMUST00000189805
SMART Domains Protein: ENSMUSP00000140883
Gene: ENSMUSG00000026413

DomainStartEndE-ValueType
low complexity region 52 60 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This protein may be involved in molecular recruitment and stabilization during desmosome formation. Mutations in this gene have been associated with the ectodermal dysplasia/skin fragility syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced birth weight, absent whiskers, and neonatal lethality associated with skin fragility, skin lesions, loss of desmosomal adhesion, and impaired skin barrier function due to abnormal tight junction formation. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,280,501 V198A possibly damaging Het
Adgra2 A T 8: 27,119,165 M805L probably benign Het
Arhgap39 T C 15: 76,736,512 S630G probably damaging Het
Bcl3 T A 7: 19,812,484 N142I probably damaging Het
Ccdc173 C T 2: 69,772,054 E338K possibly damaging Het
Chuk A T 19: 44,096,992 D238E probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Cyp2j8 A T 4: 96,507,190 L66Q possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dst T A 1: 34,188,172 D1290E probably damaging Het
Dysf T C 6: 84,098,253 I583T probably benign Het
Fbxl2 T A 9: 113,986,448 D249V probably damaging Het
Fbxo30 A T 10: 11,289,858 Y108F possibly damaging Het
Fibin G T 2: 110,362,696 H34N probably damaging Het
Gabrr1 A G 4: 33,161,632 I319V probably benign Het
Gfm1 G T 3: 67,467,882 L559F possibly damaging Het
Gm14327 A T 2: 177,904,402 T40S probably benign Het
Gm21936 A T 12: 87,795,581 R24* probably null Het
Gm5134 T A 10: 75,986,025 L231Q possibly damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Grm5 A G 7: 87,602,430 probably benign Het
Hbs1l T A 10: 21,307,758 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Inpp4b A G 8: 81,952,184 Q281R probably damaging Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Ldlrap1 C T 4: 134,759,034 R38Q possibly damaging Het
Lepr A G 4: 101,814,391 probably null Het
Map3k12 A G 15: 102,503,646 S328P probably damaging Het
Mrpl2 T C 17: 46,647,430 V46A probably benign Het
Muc16 A T 9: 18,656,998 N1408K unknown Het
Myh7 T A 14: 54,989,296 Q366L probably benign Het
Nbeal2 A G 9: 110,638,734 V462A probably damaging Het
Nradd G T 9: 110,621,587 T174N probably damaging Het
Nup155 T C 15: 8,109,479 S12P probably benign Het
Obscn C A 11: 59,052,511 E4832* probably null Het
Olfr1196 G T 2: 88,700,817 H171N probably benign Het
Olfr1416 T C 1: 92,480,583 I13V probably benign Het
Olfr1477 G A 19: 13,503,063 C240Y probably damaging Het
Olfr322 T A 11: 58,665,931 V124E possibly damaging Het
Olfr629 T A 7: 103,740,454 H262L probably damaging Het
Olfr697 A T 7: 106,741,554 C127S probably damaging Het
Opn3 G A 1: 175,663,103 R331W probably damaging Het
Phip A G 9: 82,903,181 V827A probably benign Het
Phldb1 G A 9: 44,696,117 R1264W probably damaging Het
Pibf1 T G 14: 99,186,578 I529S probably benign Het
Pla2g4f G T 2: 120,302,221 D711E possibly damaging Het
Pold1 A G 7: 44,540,842 probably null Het
Pold2 T C 11: 5,873,691 S287G probably benign Het
Prg4 T C 1: 150,455,816 probably benign Het
Prl8a1 T C 13: 27,575,574 E160G possibly damaging Het
Rfc4 C T 16: 23,114,090 probably benign Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph14 G A 10: 74,961,688 R156W probably benign Het
Sec61a1 T C 6: 88,505,168 Y457C probably benign Het
Sec63 T A 10: 42,828,865 probably null Het
Spen T C 4: 141,517,022 E234G unknown Het
Sphkap T A 1: 83,280,479 E181V probably damaging Het
Stau2 C T 1: 16,374,811 A298T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,170,433 I661V probably benign Het
Thoc6 A C 17: 23,670,321 probably null Het
Trpv1 T A 11: 73,250,810 M553K possibly damaging Het
Ttn T C 2: 76,811,235 I11760V probably benign Het
Vmn1r61 G A 7: 5,610,851 H155Y probably damaging Het
Vmn2r41 A G 7: 8,150,215 probably null Het
Vmn2r74 A G 7: 85,958,290 I75T possibly damaging Het
Wwp2 C A 8: 107,506,345 T205K probably benign Het
Zfp747 C T 7: 127,374,134 G288D probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Zfp953 G A 13: 67,343,097 L264F possibly damaging Het
Other mutations in Pkp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Pkp1 APN 1 135878184 missense probably damaging 0.96
IGL02113:Pkp1 APN 1 135883914 missense possibly damaging 0.92
IGL02149:Pkp1 APN 1 135886747 missense probably benign 0.00
IGL02582:Pkp1 APN 1 135889926 missense probably damaging 0.99
IGL02655:Pkp1 APN 1 135889773 missense probably benign 0.14
IGL03166:Pkp1 APN 1 135878124 missense probably damaging 1.00
P0008:Pkp1 UTSW 1 135875683 missense probably benign 0.00
R0180:Pkp1 UTSW 1 135886800 missense probably benign 0.00
R0368:Pkp1 UTSW 1 135875683 missense probably benign
R0368:Pkp1 UTSW 1 135886852 missense probably benign 0.00
R0601:Pkp1 UTSW 1 135878182 missense probably damaging 1.00
R0725:Pkp1 UTSW 1 135880740 missense probably benign 0.02
R1414:Pkp1 UTSW 1 135884085 splice site probably benign
R1926:Pkp1 UTSW 1 135877673 missense probably benign
R2082:Pkp1 UTSW 1 135884976 missense possibly damaging 0.48
R2190:Pkp1 UTSW 1 135879971 missense probably benign 0.02
R2249:Pkp1 UTSW 1 135880807 missense probably damaging 1.00
R4457:Pkp1 UTSW 1 135875624 makesense probably null
R4838:Pkp1 UTSW 1 135882588 missense probably damaging 1.00
R4885:Pkp1 UTSW 1 135918952 missense possibly damaging 0.92
R4995:Pkp1 UTSW 1 135880855 missense possibly damaging 0.91
R5436:Pkp1 UTSW 1 135918918 missense probably damaging 1.00
R5440:Pkp1 UTSW 1 135882492 missense probably benign 0.41
R5652:Pkp1 UTSW 1 135882597 critical splice acceptor site probably null
R5898:Pkp1 UTSW 1 135882521 missense probably damaging 1.00
R5908:Pkp1 UTSW 1 135918883 nonsense probably null
R6006:Pkp1 UTSW 1 135877668 splice site probably null
R6013:Pkp1 UTSW 1 135883910 missense probably damaging 1.00
R6218:Pkp1 UTSW 1 135879908 missense probably damaging 0.96
R7000:Pkp1 UTSW 1 135889954 missense probably benign 0.41
R7799:Pkp1 UTSW 1 135889957 missense possibly damaging 0.94
R7883:Pkp1 UTSW 1 135884903 critical splice donor site probably null
R7966:Pkp1 UTSW 1 135884903 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAACTACGCAGTGCTTCCAC -3'
(R):5'- TGTAGGGAGCTGTTCACAAG -3'

Sequencing Primer
(F):5'- CACTCTTCTCCAAAGGTGGG -3'
(R):5'- AGATTTTCTCCAAGACAGCCTG -3'
Posted On2018-02-28