Incidental Mutation 'R6232:Tbc1d2'
ID504661
Institutional Source Beutler Lab
Gene Symbol Tbc1d2
Ensembl Gene ENSMUSG00000039813
Gene NameTBC1 domain family, member 2
SynonymsPARIS-1, A630005A06Rik, LOC381605, PARIS1
MMRRC Submission 044360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6232 (G1)
Quality Score197.009
Status Validated
Chromosome4
Chromosomal Location46604390-46650209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46629912 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 252 (G252R)
Ref Sequence ENSEMBL: ENSMUSP00000081670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084621] [ENSMUST00000107750]
Predicted Effect probably benign
Transcript: ENSMUST00000084621
AA Change: G252R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081670
Gene: ENSMUSG00000039813
AA Change: G252R

DomainStartEndE-ValueType
PH 44 143 1.94e-11 SMART
low complexity region 147 159 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
coiled coil region 362 394 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
Blast:TBC 454 491 3e-14 BLAST
low complexity region 526 539 N/A INTRINSIC
Blast:TBC 557 591 3e-10 BLAST
TBC 616 834 1.63e-60 SMART
coiled coil region 869 906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107750
SMART Domains Protein: ENSMUSP00000103379
Gene: ENSMUSG00000039813

DomainStartEndE-ValueType
PH 44 143 1.94e-11 SMART
low complexity region 147 159 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 94% (64/68)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,280,501 V198A possibly damaging Het
Adgra2 A T 8: 27,119,165 M805L probably benign Het
Arhgap39 T C 15: 76,736,512 S630G probably damaging Het
Bcl3 T A 7: 19,812,484 N142I probably damaging Het
Ccdc173 C T 2: 69,772,054 E338K possibly damaging Het
Chuk A T 19: 44,096,992 D238E probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Cyp2j8 A T 4: 96,507,190 L66Q possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dst T A 1: 34,188,172 D1290E probably damaging Het
Dysf T C 6: 84,098,253 I583T probably benign Het
Fbxl2 T A 9: 113,986,448 D249V probably damaging Het
Fbxo30 A T 10: 11,289,858 Y108F possibly damaging Het
Fibin G T 2: 110,362,696 H34N probably damaging Het
Gabrr1 A G 4: 33,161,632 I319V probably benign Het
Gfm1 G T 3: 67,467,882 L559F possibly damaging Het
Gm14327 A T 2: 177,904,402 T40S probably benign Het
Gm21936 A T 12: 87,795,581 R24* probably null Het
Gm5134 T A 10: 75,986,025 L231Q possibly damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Grm5 A G 7: 87,602,430 probably benign Het
Hbs1l T A 10: 21,307,758 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Inpp4b A G 8: 81,952,184 Q281R probably damaging Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Ldlrap1 C T 4: 134,759,034 R38Q possibly damaging Het
Lepr A G 4: 101,814,391 probably null Het
Map3k12 A G 15: 102,503,646 S328P probably damaging Het
Mrpl2 T C 17: 46,647,430 V46A probably benign Het
Muc16 A T 9: 18,656,998 N1408K unknown Het
Myh7 T A 14: 54,989,296 Q366L probably benign Het
Nbeal2 A G 9: 110,638,734 V462A probably damaging Het
Nradd G T 9: 110,621,587 T174N probably damaging Het
Nup155 T C 15: 8,109,479 S12P probably benign Het
Obscn C A 11: 59,052,511 E4832* probably null Het
Olfr1196 G T 2: 88,700,817 H171N probably benign Het
Olfr1416 T C 1: 92,480,583 I13V probably benign Het
Olfr1477 G A 19: 13,503,063 C240Y probably damaging Het
Olfr322 T A 11: 58,665,931 V124E possibly damaging Het
Olfr629 T A 7: 103,740,454 H262L probably damaging Het
Olfr697 A T 7: 106,741,554 C127S probably damaging Het
Opn3 G A 1: 175,663,103 R331W probably damaging Het
Phip A G 9: 82,903,181 V827A probably benign Het
Phldb1 G A 9: 44,696,117 R1264W probably damaging Het
Pibf1 T G 14: 99,186,578 I529S probably benign Het
Pkp1 T A 1: 135,886,861 I241F probably benign Het
Pla2g4f G T 2: 120,302,221 D711E possibly damaging Het
Pold1 A G 7: 44,540,842 probably null Het
Pold2 T C 11: 5,873,691 S287G probably benign Het
Prg4 T C 1: 150,455,816 probably benign Het
Prl8a1 T C 13: 27,575,574 E160G possibly damaging Het
Rfc4 C T 16: 23,114,090 probably benign Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph14 G A 10: 74,961,688 R156W probably benign Het
Sec61a1 T C 6: 88,505,168 Y457C probably benign Het
Sec63 T A 10: 42,828,865 probably null Het
Spen T C 4: 141,517,022 E234G unknown Het
Sphkap T A 1: 83,280,479 E181V probably damaging Het
Stau2 C T 1: 16,374,811 A298T probably benign Het
Tbc1d23 T C 16: 57,170,433 I661V probably benign Het
Thoc6 A C 17: 23,670,321 probably null Het
Trpv1 T A 11: 73,250,810 M553K possibly damaging Het
Ttn T C 2: 76,811,235 I11760V probably benign Het
Vmn1r61 G A 7: 5,610,851 H155Y probably damaging Het
Vmn2r41 A G 7: 8,150,215 probably null Het
Vmn2r74 A G 7: 85,958,290 I75T possibly damaging Het
Wwp2 C A 8: 107,506,345 T205K probably benign Het
Zfp747 C T 7: 127,374,134 G288D probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Zfp953 G A 13: 67,343,097 L264F possibly damaging Het
Other mutations in Tbc1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Tbc1d2 APN 4 46649745 missense probably benign 0.04
IGL01748:Tbc1d2 APN 4 46616306 missense probably damaging 0.99
IGL01863:Tbc1d2 APN 4 46607064 missense possibly damaging 0.66
IGL02014:Tbc1d2 APN 4 46649778 missense possibly damaging 0.83
IGL02025:Tbc1d2 APN 4 46620713 missense probably damaging 1.00
IGL02551:Tbc1d2 APN 4 46649916 missense probably benign
IGL02571:Tbc1d2 APN 4 46628370 missense probably benign 0.00
IGL03149:Tbc1d2 APN 4 46637619 missense probably benign 0.31
R0347:Tbc1d2 UTSW 4 46620574 missense possibly damaging 0.82
R0374:Tbc1d2 UTSW 4 46649913 missense possibly damaging 0.95
R0522:Tbc1d2 UTSW 4 46649806 missense probably damaging 1.00
R0883:Tbc1d2 UTSW 4 46609003 nonsense probably null
R1227:Tbc1d2 UTSW 4 46620629 missense probably benign 0.00
R1464:Tbc1d2 UTSW 4 46606491 missense possibly damaging 0.51
R1464:Tbc1d2 UTSW 4 46606491 missense possibly damaging 0.51
R1658:Tbc1d2 UTSW 4 46614207 missense probably damaging 1.00
R1959:Tbc1d2 UTSW 4 46606419 missense probably benign 0.44
R2108:Tbc1d2 UTSW 4 46637652 missense possibly damaging 0.62
R3864:Tbc1d2 UTSW 4 46620484 missense probably benign 0.01
R4475:Tbc1d2 UTSW 4 46609080 missense possibly damaging 0.92
R5112:Tbc1d2 UTSW 4 46606503 missense probably damaging 1.00
R5127:Tbc1d2 UTSW 4 46633639 intron probably benign
R5215:Tbc1d2 UTSW 4 46614006 missense probably benign 0.42
R5475:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5550:Tbc1d2 UTSW 4 46646138 missense probably benign 0.00
R5558:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5564:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5599:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5600:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5699:Tbc1d2 UTSW 4 46616298 missense probably benign 0.31
R5866:Tbc1d2 UTSW 4 46637715 missense possibly damaging 0.80
R5909:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5911:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5980:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6194:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6195:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6209:Tbc1d2 UTSW 4 46614068 missense probably damaging 1.00
R6211:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6242:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6261:Tbc1d2 UTSW 4 46637692 missense possibly damaging 0.47
R6273:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6274:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6285:Tbc1d2 UTSW 4 46615045 missense possibly damaging 0.49
R6333:Tbc1d2 UTSW 4 46620736 missense possibly damaging 0.64
R6369:Tbc1d2 UTSW 4 46614420 missense probably benign 0.41
R6912:Tbc1d2 UTSW 4 46649712 missense probably damaging 1.00
R7428:Tbc1d2 UTSW 4 46649965 missense probably benign 0.02
R7824:Tbc1d2 UTSW 4 46637746 splice site probably null
R8069:Tbc1d2 UTSW 4 46649737 missense possibly damaging 0.81
X0023:Tbc1d2 UTSW 4 46615037 missense probably benign 0.00
X0063:Tbc1d2 UTSW 4 46606492 missense probably damaging 1.00
Z1177:Tbc1d2 UTSW 4 46650016 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCTGAGTCAGCCTGGGTG -3'
(R):5'- TGAGGCCAGAGCTCTGCAG -3'

Sequencing Primer
(F):5'- CAGCCCCATGATAGGATTAGTGTC -3'
(R):5'- AGAGCTCTGCAGGCAGC -3'
Posted On2018-02-28