Incidental Mutation 'R6232:Olfr697'
ID504677
Institutional Source Beutler Lab
Gene Symbol Olfr697
Ensembl Gene ENSMUSG00000051591
Gene Nameolfactory receptor 697
SynonymsGA_x6K02T2PBJ9-9119301-9118348, MOR283-5
MMRRC Submission 044360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6232 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106740834-106742443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106741554 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 127 (C127S)
Ref Sequence ENSEMBL: ENSMUSP00000152039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050541] [ENSMUST00000217734]
Predicted Effect probably damaging
Transcript: ENSMUST00000050541
AA Change: C127S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055207
Gene: ENSMUSG00000051591
AA Change: C127S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.7e-7 PFAM
Pfam:7tm_1 41 290 8.7e-26 PFAM
Pfam:7TM_GPCR_Srx 69 306 4.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217734
AA Change: C127S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,280,501 V198A possibly damaging Het
Adgra2 A T 8: 27,119,165 M805L probably benign Het
Arhgap39 T C 15: 76,736,512 S630G probably damaging Het
Bcl3 T A 7: 19,812,484 N142I probably damaging Het
Ccdc173 C T 2: 69,772,054 E338K possibly damaging Het
Chuk A T 19: 44,096,992 D238E probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Cyp2j8 A T 4: 96,507,190 L66Q possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dst T A 1: 34,188,172 D1290E probably damaging Het
Dysf T C 6: 84,098,253 I583T probably benign Het
Fbxl2 T A 9: 113,986,448 D249V probably damaging Het
Fbxo30 A T 10: 11,289,858 Y108F possibly damaging Het
Fibin G T 2: 110,362,696 H34N probably damaging Het
Gabrr1 A G 4: 33,161,632 I319V probably benign Het
Gfm1 G T 3: 67,467,882 L559F possibly damaging Het
Gm14327 A T 2: 177,904,402 T40S probably benign Het
Gm21936 A T 12: 87,795,581 R24* probably null Het
Gm5134 T A 10: 75,986,025 L231Q possibly damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Grm5 A G 7: 87,602,430 probably benign Het
Hbs1l T A 10: 21,307,758 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Inpp4b A G 8: 81,952,184 Q281R probably damaging Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Ldlrap1 C T 4: 134,759,034 R38Q possibly damaging Het
Lepr A G 4: 101,814,391 probably null Het
Map3k12 A G 15: 102,503,646 S328P probably damaging Het
Mrpl2 T C 17: 46,647,430 V46A probably benign Het
Muc16 A T 9: 18,656,998 N1408K unknown Het
Myh7 T A 14: 54,989,296 Q366L probably benign Het
Nbeal2 A G 9: 110,638,734 V462A probably damaging Het
Nradd G T 9: 110,621,587 T174N probably damaging Het
Nup155 T C 15: 8,109,479 S12P probably benign Het
Obscn C A 11: 59,052,511 E4832* probably null Het
Olfr1196 G T 2: 88,700,817 H171N probably benign Het
Olfr1416 T C 1: 92,480,583 I13V probably benign Het
Olfr1477 G A 19: 13,503,063 C240Y probably damaging Het
Olfr322 T A 11: 58,665,931 V124E possibly damaging Het
Olfr629 T A 7: 103,740,454 H262L probably damaging Het
Opn3 G A 1: 175,663,103 R331W probably damaging Het
Phip A G 9: 82,903,181 V827A probably benign Het
Phldb1 G A 9: 44,696,117 R1264W probably damaging Het
Pibf1 T G 14: 99,186,578 I529S probably benign Het
Pkp1 T A 1: 135,886,861 I241F probably benign Het
Pla2g4f G T 2: 120,302,221 D711E possibly damaging Het
Pold1 A G 7: 44,540,842 probably null Het
Pold2 T C 11: 5,873,691 S287G probably benign Het
Prg4 T C 1: 150,455,816 probably benign Het
Prl8a1 T C 13: 27,575,574 E160G possibly damaging Het
Rfc4 C T 16: 23,114,090 probably benign Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph14 G A 10: 74,961,688 R156W probably benign Het
Sec61a1 T C 6: 88,505,168 Y457C probably benign Het
Sec63 T A 10: 42,828,865 probably null Het
Spen T C 4: 141,517,022 E234G unknown Het
Sphkap T A 1: 83,280,479 E181V probably damaging Het
Stau2 C T 1: 16,374,811 A298T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,170,433 I661V probably benign Het
Thoc6 A C 17: 23,670,321 probably null Het
Trpv1 T A 11: 73,250,810 M553K possibly damaging Het
Ttn T C 2: 76,811,235 I11760V probably benign Het
Vmn1r61 G A 7: 5,610,851 H155Y probably damaging Het
Vmn2r41 A G 7: 8,150,215 probably null Het
Vmn2r74 A G 7: 85,958,290 I75T possibly damaging Het
Wwp2 C A 8: 107,506,345 T205K probably benign Het
Zfp747 C T 7: 127,374,134 G288D probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Zfp953 G A 13: 67,343,097 L264F possibly damaging Het
Other mutations in Olfr697
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr697 APN 7 106741701 missense probably benign 0.20
IGL00937:Olfr697 APN 7 106741157 missense probably damaging 1.00
IGL01368:Olfr697 APN 7 106741622 missense probably benign 0.19
IGL01410:Olfr697 APN 7 106741499 missense probably benign 0.19
IGL01415:Olfr697 APN 7 106741499 missense probably benign 0.19
IGL01962:Olfr697 APN 7 106741784 missense probably benign 0.12
IGL02654:Olfr697 APN 7 106741348 nonsense probably null
IGL02903:Olfr697 APN 7 106741710 missense probably damaging 1.00
IGL03347:Olfr697 APN 7 106740970 utr 3 prime probably benign
IGL03391:Olfr697 APN 7 106741755 missense probably damaging 1.00
R0139:Olfr697 UTSW 7 106741625 missense probably benign 0.05
R0142:Olfr697 UTSW 7 106741765 missense probably benign 0.36
R1293:Olfr697 UTSW 7 106741851 missense probably damaging 0.98
R1522:Olfr697 UTSW 7 106741005 missense probably benign 0.03
R1715:Olfr697 UTSW 7 106741548 missense probably damaging 1.00
R1959:Olfr697 UTSW 7 106741394 missense probably damaging 1.00
R1960:Olfr697 UTSW 7 106741394 missense probably damaging 1.00
R2031:Olfr697 UTSW 7 106741898 missense probably damaging 1.00
R4790:Olfr697 UTSW 7 106741791 missense probably benign 0.05
R5550:Olfr697 UTSW 7 106741133 missense probably benign 0.01
R6293:Olfr697 UTSW 7 106741406 missense probably damaging 1.00
R6643:Olfr697 UTSW 7 106741704 missense probably benign 0.06
R7831:Olfr697 UTSW 7 106741413 missense probably damaging 0.99
R7914:Olfr697 UTSW 7 106741413 missense probably damaging 0.99
R8013:Olfr697 UTSW 7 106741617 missense probably benign 0.00
R8014:Olfr697 UTSW 7 106741617 missense probably benign 0.00
RF018:Olfr697 UTSW 7 106741485 missense probably benign 0.02
X0020:Olfr697 UTSW 7 106741136 missense probably damaging 0.97
Z1088:Olfr697 UTSW 7 106741143 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GTGTCTGCACAGGCCAAATC -3'
(R):5'- CATGTACCTTCTACTTGGGCAG -3'

Sequencing Primer
(F):5'- TCCAGCAAGGGAGGGATCTC -3'
(R):5'- GGGCAGCTCTCTCTCATTG -3'
Posted On2018-02-28