Incidental Mutation 'R6232:Sec63'
ID504692
Institutional Source Beutler Lab
Gene Symbol Sec63
Ensembl Gene ENSMUSG00000019802
Gene NameSEC63-like (S. cerevisiae)
Synonyms
MMRRC Submission 044360-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6232 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location42761496-42832514 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 42828865 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019937]
Predicted Effect probably null
Transcript: ENSMUST00000019937
SMART Domains Protein: ENSMUSP00000019937
Gene: ENSMUSG00000019802

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
DnaJ 103 157 6.14e-23 SMART
Blast:Sec63 170 208 9e-6 BLAST
Sec63 219 714 6.98e-10 SMART
low complexity region 734 760 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155410
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 94% (64/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC62 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in the kidneys or ubiquitously develop polycystic kidney and liver phenotypes, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,280,501 V198A possibly damaging Het
Adgra2 A T 8: 27,119,165 M805L probably benign Het
Arhgap39 T C 15: 76,736,512 S630G probably damaging Het
Bcl3 T A 7: 19,812,484 N142I probably damaging Het
Ccdc173 C T 2: 69,772,054 E338K possibly damaging Het
Chuk A T 19: 44,096,992 D238E probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Cyp2j8 A T 4: 96,507,190 L66Q possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dst T A 1: 34,188,172 D1290E probably damaging Het
Dysf T C 6: 84,098,253 I583T probably benign Het
Fbxl2 T A 9: 113,986,448 D249V probably damaging Het
Fbxo30 A T 10: 11,289,858 Y108F possibly damaging Het
Fibin G T 2: 110,362,696 H34N probably damaging Het
Gabrr1 A G 4: 33,161,632 I319V probably benign Het
Gfm1 G T 3: 67,467,882 L559F possibly damaging Het
Gm14327 A T 2: 177,904,402 T40S probably benign Het
Gm21936 A T 12: 87,795,581 R24* probably null Het
Gm5134 T A 10: 75,986,025 L231Q possibly damaging Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Grm5 A G 7: 87,602,430 probably benign Het
Hbs1l T A 10: 21,307,758 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Inpp4b A G 8: 81,952,184 Q281R probably damaging Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Ldlrap1 C T 4: 134,759,034 R38Q possibly damaging Het
Lepr A G 4: 101,814,391 probably null Het
Map3k12 A G 15: 102,503,646 S328P probably damaging Het
Mrpl2 T C 17: 46,647,430 V46A probably benign Het
Muc16 A T 9: 18,656,998 N1408K unknown Het
Myh7 T A 14: 54,989,296 Q366L probably benign Het
Nbeal2 A G 9: 110,638,734 V462A probably damaging Het
Nradd G T 9: 110,621,587 T174N probably damaging Het
Nup155 T C 15: 8,109,479 S12P probably benign Het
Obscn C A 11: 59,052,511 E4832* probably null Het
Olfr1196 G T 2: 88,700,817 H171N probably benign Het
Olfr1416 T C 1: 92,480,583 I13V probably benign Het
Olfr1477 G A 19: 13,503,063 C240Y probably damaging Het
Olfr322 T A 11: 58,665,931 V124E possibly damaging Het
Olfr629 T A 7: 103,740,454 H262L probably damaging Het
Olfr697 A T 7: 106,741,554 C127S probably damaging Het
Opn3 G A 1: 175,663,103 R331W probably damaging Het
Phip A G 9: 82,903,181 V827A probably benign Het
Phldb1 G A 9: 44,696,117 R1264W probably damaging Het
Pibf1 T G 14: 99,186,578 I529S probably benign Het
Pkp1 T A 1: 135,886,861 I241F probably benign Het
Pla2g4f G T 2: 120,302,221 D711E possibly damaging Het
Pold1 A G 7: 44,540,842 probably null Het
Pold2 T C 11: 5,873,691 S287G probably benign Het
Prg4 T C 1: 150,455,816 probably benign Het
Prl8a1 T C 13: 27,575,574 E160G possibly damaging Het
Rfc4 C T 16: 23,114,090 probably benign Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph14 G A 10: 74,961,688 R156W probably benign Het
Sec61a1 T C 6: 88,505,168 Y457C probably benign Het
Spen T C 4: 141,517,022 E234G unknown Het
Sphkap T A 1: 83,280,479 E181V probably damaging Het
Stau2 C T 1: 16,374,811 A298T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,170,433 I661V probably benign Het
Thoc6 A C 17: 23,670,321 probably null Het
Trpv1 T A 11: 73,250,810 M553K possibly damaging Het
Ttn T C 2: 76,811,235 I11760V probably benign Het
Vmn1r61 G A 7: 5,610,851 H155Y probably damaging Het
Vmn2r41 A G 7: 8,150,215 probably null Het
Vmn2r74 A G 7: 85,958,290 I75T possibly damaging Het
Wwp2 C A 8: 107,506,345 T205K probably benign Het
Zfp747 C T 7: 127,374,134 G288D probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Zfp953 G A 13: 67,343,097 L264F possibly damaging Het
Other mutations in Sec63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Sec63 APN 10 42812457 missense possibly damaging 0.56
IGL02111:Sec63 APN 10 42810888 missense probably damaging 1.00
IGL02457:Sec63 APN 10 42801733 splice site probably benign
IGL02613:Sec63 APN 10 42801707 missense probably damaging 1.00
IGL03002:Sec63 APN 10 42810909 missense possibly damaging 0.51
IGL03493:Sec63 APN 10 42828941 missense probably benign 0.06
cyst UTSW 10 42828865 splice site probably null
R0233:Sec63 UTSW 10 42823908 missense possibly damaging 0.48
R0233:Sec63 UTSW 10 42823908 missense possibly damaging 0.48
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0538:Sec63 UTSW 10 42798799 missense probably benign 0.01
R0734:Sec63 UTSW 10 42796208 missense probably benign 0.08
R0906:Sec63 UTSW 10 42801928 missense probably damaging 0.98
R1136:Sec63 UTSW 10 42806546 missense probably damaging 1.00
R1665:Sec63 UTSW 10 42798728 splice site probably null
R1736:Sec63 UTSW 10 42827918 nonsense probably null
R1961:Sec63 UTSW 10 42823886 missense probably damaging 1.00
R2696:Sec63 UTSW 10 42783526 missense probably benign 0.05
R4886:Sec63 UTSW 10 42789393 nonsense probably null
R4908:Sec63 UTSW 10 42805190 missense probably damaging 0.99
R5174:Sec63 UTSW 10 42829081 utr 3 prime probably benign
R5619:Sec63 UTSW 10 42789382 missense probably damaging 1.00
R5766:Sec63 UTSW 10 42801681 missense probably damaging 0.99
R5820:Sec63 UTSW 10 42796245 missense possibly damaging 0.49
R6656:Sec63 UTSW 10 42816383 nonsense probably null
R6847:Sec63 UTSW 10 42791253 missense probably damaging 1.00
R6971:Sec63 UTSW 10 42783442 missense probably damaging 1.00
R8037:Sec63 UTSW 10 42783487 missense probably benign 0.00
RF010:Sec63 UTSW 10 42806624 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCTTGAACTTCCACAGAGTC -3'
(R):5'- TGTAGTCCACTCACTCGGGTTAG -3'

Sequencing Primer
(F):5'- GCTTGAACTTCCACAGAGTCAAAATG -3'
(R):5'- ACTCGGGTTAGTCTCCACC -3'
Posted On2018-02-28