Incidental Mutation 'R6232:Gm5134'
ID504694
Institutional Source Beutler Lab
Gene Symbol Gm5134
Ensembl Gene ENSMUSG00000033255
Gene Namepredicted gene 5134
Synonyms
MMRRC Submission 044360-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6232 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75954514-76009591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75986025 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 231 (L231Q)
Ref Sequence ENSEMBL: ENSMUSP00000097172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099577
AA Change: L231Q

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097172
Gene: ENSMUSG00000033255
AA Change: L231Q

DomainStartEndE-ValueType
Pfam:SSF 32 466 2.9e-119 PFAM
transmembrane domain 500 522 N/A INTRINSIC
transmembrane domain 651 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134234
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.7%
Validation Efficiency 94% (64/68)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,280,501 V198A possibly damaging Het
Adgra2 A T 8: 27,119,165 M805L probably benign Het
Arhgap39 T C 15: 76,736,512 S630G probably damaging Het
Bcl3 T A 7: 19,812,484 N142I probably damaging Het
Ccdc173 C T 2: 69,772,054 E338K possibly damaging Het
Chuk A T 19: 44,096,992 D238E probably benign Het
Cnga4 T G 7: 105,407,699 Y336* probably null Het
Cyp2j8 A T 4: 96,507,190 L66Q possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dst T A 1: 34,188,172 D1290E probably damaging Het
Dysf T C 6: 84,098,253 I583T probably benign Het
Fbxl2 T A 9: 113,986,448 D249V probably damaging Het
Fbxo30 A T 10: 11,289,858 Y108F possibly damaging Het
Fibin G T 2: 110,362,696 H34N probably damaging Het
Gabrr1 A G 4: 33,161,632 I319V probably benign Het
Gfm1 G T 3: 67,467,882 L559F possibly damaging Het
Gm14327 A T 2: 177,904,402 T40S probably benign Het
Gm21936 A T 12: 87,795,581 R24* probably null Het
Gm5346 T G 8: 43,625,912 N425T probably benign Het
Grm5 A G 7: 87,602,430 probably benign Het
Hbs1l T A 10: 21,307,758 probably null Het
Hsf5 C G 11: 87,617,294 T8S probably benign Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Inpp4b A G 8: 81,952,184 Q281R probably damaging Het
Krt40 G A 11: 99,543,094 A22V possibly damaging Het
Ldlrap1 C T 4: 134,759,034 R38Q possibly damaging Het
Lepr A G 4: 101,814,391 probably null Het
Map3k12 A G 15: 102,503,646 S328P probably damaging Het
Mrpl2 T C 17: 46,647,430 V46A probably benign Het
Muc16 A T 9: 18,656,998 N1408K unknown Het
Myh7 T A 14: 54,989,296 Q366L probably benign Het
Nbeal2 A G 9: 110,638,734 V462A probably damaging Het
Nradd G T 9: 110,621,587 T174N probably damaging Het
Nup155 T C 15: 8,109,479 S12P probably benign Het
Obscn C A 11: 59,052,511 E4832* probably null Het
Olfr1196 G T 2: 88,700,817 H171N probably benign Het
Olfr1416 T C 1: 92,480,583 I13V probably benign Het
Olfr1477 G A 19: 13,503,063 C240Y probably damaging Het
Olfr322 T A 11: 58,665,931 V124E possibly damaging Het
Olfr629 T A 7: 103,740,454 H262L probably damaging Het
Olfr697 A T 7: 106,741,554 C127S probably damaging Het
Opn3 G A 1: 175,663,103 R331W probably damaging Het
Phip A G 9: 82,903,181 V827A probably benign Het
Phldb1 G A 9: 44,696,117 R1264W probably damaging Het
Pibf1 T G 14: 99,186,578 I529S probably benign Het
Pkp1 T A 1: 135,886,861 I241F probably benign Het
Pla2g4f G T 2: 120,302,221 D711E possibly damaging Het
Pold1 A G 7: 44,540,842 probably null Het
Pold2 T C 11: 5,873,691 S287G probably benign Het
Prg4 T C 1: 150,455,816 probably benign Het
Prl8a1 T C 13: 27,575,574 E160G possibly damaging Het
Rfc4 C T 16: 23,114,090 probably benign Het
Robo3 T G 9: 37,420,929 Y891S probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsph14 G A 10: 74,961,688 R156W probably benign Het
Sec61a1 T C 6: 88,505,168 Y457C probably benign Het
Sec63 T A 10: 42,828,865 probably null Het
Spen T C 4: 141,517,022 E234G unknown Het
Sphkap T A 1: 83,280,479 E181V probably damaging Het
Stau2 C T 1: 16,374,811 A298T probably benign Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tbc1d23 T C 16: 57,170,433 I661V probably benign Het
Thoc6 A C 17: 23,670,321 probably null Het
Trpv1 T A 11: 73,250,810 M553K possibly damaging Het
Ttn T C 2: 76,811,235 I11760V probably benign Het
Vmn1r61 G A 7: 5,610,851 H155Y probably damaging Het
Vmn2r41 A G 7: 8,150,215 probably null Het
Vmn2r74 A G 7: 85,958,290 I75T possibly damaging Het
Wwp2 C A 8: 107,506,345 T205K probably benign Het
Zfp747 C T 7: 127,374,134 G288D probably damaging Het
Zfp871 CCACAC CC 17: 32,775,520 probably null Het
Zfp953 G A 13: 67,343,097 L264F possibly damaging Het
Other mutations in Gm5134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Gm5134 APN 10 76000421 missense possibly damaging 0.70
IGL01371:Gm5134 APN 10 76004747 missense probably damaging 0.99
IGL02140:Gm5134 APN 10 75986111 missense probably benign 0.03
IGL02197:Gm5134 APN 10 75954702 critical splice donor site probably null
IGL02233:Gm5134 APN 10 76008500 critical splice acceptor site probably null
IGL02612:Gm5134 APN 10 75992489 missense probably damaging 1.00
IGL02896:Gm5134 APN 10 75974224 missense possibly damaging 0.82
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0110:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R0499:Gm5134 UTSW 10 75992525 missense probably benign 0.00
R0510:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R1429:Gm5134 UTSW 10 75978381 missense probably damaging 1.00
R1726:Gm5134 UTSW 10 75992527 missense possibly damaging 0.83
R1918:Gm5134 UTSW 10 75976346 missense possibly damaging 0.70
R1956:Gm5134 UTSW 10 76004846 missense possibly damaging 0.89
R1993:Gm5134 UTSW 10 75966393 missense probably damaging 0.96
R2049:Gm5134 UTSW 10 76004884 missense possibly damaging 0.92
R2188:Gm5134 UTSW 10 75995836 missense probably damaging 1.00
R3551:Gm5134 UTSW 10 76000447 missense probably benign 0.08
R4074:Gm5134 UTSW 10 76008531 missense probably damaging 1.00
R4435:Gm5134 UTSW 10 75995824 missense probably damaging 1.00
R4466:Gm5134 UTSW 10 76008575 missense probably benign 0.00
R5180:Gm5134 UTSW 10 75976366 missense probably damaging 1.00
R5446:Gm5134 UTSW 10 75995836 missense probably damaging 1.00
R5601:Gm5134 UTSW 10 75985952 missense probably damaging 0.98
R5627:Gm5134 UTSW 10 75986108 missense possibly damaging 0.93
R5777:Gm5134 UTSW 10 76004760 missense probably benign 0.00
R5867:Gm5134 UTSW 10 76008616 missense probably benign 0.00
R6145:Gm5134 UTSW 10 75995839 missense probably damaging 0.99
R6271:Gm5134 UTSW 10 75995809 missense probably benign 0.32
R6329:Gm5134 UTSW 10 75954660 missense possibly damaging 0.68
R6723:Gm5134 UTSW 10 76008619 missense probably benign
R7049:Gm5134 UTSW 10 75992458 missense probably damaging 0.97
R7305:Gm5134 UTSW 10 76000399 missense probably damaging 1.00
R7579:Gm5134 UTSW 10 75964437 missense probably damaging 1.00
X0050:Gm5134 UTSW 10 75992510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGATGGTCACACTGGCTC -3'
(R):5'- TAAGCAGACAAGCCCCAGTG -3'

Sequencing Primer
(F):5'- AGATGGTCACACTGGCTCTTATTTC -3'
(R):5'- AGTGGCCGGCATATGCAG -3'
Posted On2018-02-28